EMAIL THIS PAGE TO A FRIEND

DNTT

DNA nucleotidylexotransferase

Synonyms: TDT
UniProtKB ID: P04053, Q53FH1, Q5W103, Q96E50
Gene ID:
Human(1791) Summary: This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(21673) deoxynucleotidyltransferase, terminal
Rat(294051) DNA nucleotidylexotransferase
sheep(101111504) deoxynucleotidyltransferase, terminal
Domestic Rabbit(100353958) deoxynucleotidyltransferase, terminal
naked mole-rat(101718847) DNA nucleotidylexotransferase
domestic guinea pig(100717998) DNA nucleotidylexotransferase
Zebrafish(544653) deoxynucleotidyltransferase, terminal
cow(281120) deoxynucleotidyltransferase, terminal
Horse(100061113) deoxynucleotidyltransferase, terminal
domestic cat(101097099) deoxynucleotidyltransferase, terminal
dog(486815) deoxynucleotidyltransferase, terminal
chicken(396351) deoxynucleotidyltransferase, terminal
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037021 MISSION® esiRNA esiRNA human DNTT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017520 Rosetta Predictions human pricing
NM_004088 Rosetta Predictions human pricing
NM_001012461 Rosetta Predictions rat pricing
NM_001043228 Rosetta Predictions mouse pricing
NM_009345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063536 predicted 1033
2 SASI_Hs02_00306777 predicted 662
3 SASI_Hs01_00063537 predicted 1028
4 SASI_Hs01_00063539 predicted 780
5 SASI_Hs01_00063540 predicted 400
6 SASI_Hs01_00063542 predicted 245
7 SASI_Hs01_00063543 predicted 1028
8 SASI_Hs01_00063544 predicted 438
9 SASI_Hs01_00063545 predicted 977
10 SASI_Hs02_00306778 predicted 888
11 SASI_Hs01_00063538 predicted 846
12 SASI_Hs01_00063541 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169925 predicted 1040
2 SASI_Hs02_00336889 predicted 663
3 SASI_Hs01_00169926 predicted 1036
4 SASI_Hs01_00169928 predicted 783
5 SASI_Hs01_00169929 predicted 397
6 SASI_Hs01_00169931 predicted 248
7 SASI_Hs01_00169932 predicted 1029
8 SASI_Hs01_00169933 predicted 442
9 SASI_Hs01_00169934 predicted 969
10 SASI_Hs02_00336890 predicted 885
11 SASI_Hs01_00169927 predicted 850
12 SASI_Hs01_00169930 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070837 predicted 1032
2 SASI_Rn01_00070838 predicted 744
3 SASI_Rn01_00070839 predicted 1440
4 SASI_Rn01_00070840 predicted 506
5 SASI_Rn01_00070842 predicted 731
6 SASI_Rn01_00070843 predicted 705
7 SASI_Rn01_00070844 predicted 1534
8 SASI_Rn01_00070845 predicted 641
9 SASI_Rn02_00200556 predicted 798
10 SASI_Rn01_00070846 predicted 565
11 SASI_Rn01_00070841 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291145 predicted 608
2 SASI_Mm02_00291146 predicted 891
3 SASI_Mm02_00291147 predicted 829
4 SASI_Mm02_00291148 predicted 608
5 SASI_Mm02_00291149 predicted 1180
6 SASI_Mm02_00291150 predicted 869
7 SASI_Mm02_00291151 predicted 852
8 SASI_Mm02_00291152 predicted 357
9 SASI_Mm02_00291153 predicted 924
10 SASI_Mm02_00291154 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038455 predicted 615
2 SASI_Mm01_00038456 predicted 890
3 SASI_Mm01_00038457 predicted 820
4 SASI_Mm02_00315926 predicted 611
5 SASI_Mm01_00038458 predicted 1185
6 SASI_Mm01_00038459 predicted 867
7 SASI_Mm01_00038460 predicted 849
8 SASI_Mm01_00038461 predicted 361
9 SASI_Mm01_00038462 predicted 921
10 SASI_Mm01_00038463 predicted 874
11 SASI_Mm01_00038464 predicted 1639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004088
DNTT MISSION shRNA Bacterial Glycerol Stock
DNA nucleotidylexotransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1098s21c1
Sequence:CCGGGCCGTCAGTGTGCTGGTTAAACTCGAGTTTAACCAGCACACTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-907s21c1
Sequence:CCGGATCAATCCTTCAAACTCTTTACTCGAGTAAAGAGTTTGAAGGATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004088.3-1863s21c1
Sequence:CCGGGGTAATGGGTAAGGTTCTAATCTCGAGATTAGAACCTTACCCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1699s21c1
Sequence:CCGGAGGAAAGTGTTGTCAACATTTCTCGAGAAATGTTGACAACACTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1302s21c1
Sequence:CCGGGACCTTGTGGAGTCAACATTTCTCGAGAAATGTTGACTCCACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-914s1c1
Sequence:CCGGGCAGGATTTCTGTATTATGAACTCGAGTTCATAATACAGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1528s1c1
Sequence:CCGGGCATCTGGGATTGGATTATATCTCGAGATATAATCCAATCCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-902s1c1
Sequence:CCGGCGAATGCAGAAAGCAGGATTTCTCGAGAAATCCTGCTTTCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-538s1c1
Sequence:CCGGCCAGATATTCACGGATGCCTTCTCGAGAAGGCATCCGTGAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1328s1c1
Sequence:CCGGGCCATCCGTGTGGATTTAGTTCTCGAGAACTAAATCCACACGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004088
DNTT MISSION shRNA shRNA Plasmid DNA
DNA nucleotidylexotransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1098s21c1
Sequence:CCGGGCCGTCAGTGTGCTGGTTAAACTCGAGTTTAACCAGCACACTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-907s21c1
Sequence:CCGGATCAATCCTTCAAACTCTTTACTCGAGTAAAGAGTTTGAAGGATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004088.3-1863s21c1
Sequence:CCGGGGTAATGGGTAAGGTTCTAATCTCGAGATTAGAACCTTACCCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1699s21c1
Sequence:CCGGAGGAAAGTGTTGTCAACATTTCTCGAGAAATGTTGACAACACTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1302s21c1
Sequence:CCGGGACCTTGTGGAGTCAACATTTCTCGAGAAATGTTGACTCCACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-914s1c1
Sequence:CCGGGCAGGATTTCTGTATTATGAACTCGAGTTCATAATACAGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1528s1c1
Sequence:CCGGGCATCTGGGATTGGATTATATCTCGAGATATAATCCAATCCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-902s1c1
Sequence:CCGGCGAATGCAGAAAGCAGGATTTCTCGAGAAATCCTGCTTTCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-538s1c1
Sequence:CCGGCCAGATATTCACGGATGCCTTCTCGAGAAGGCATCCGTGAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1328s1c1
Sequence:CCGGGCCATCCGTGTGGATTTAGTTCTCGAGAACTAAATCCACACGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004088
DNTT MISSION shRNA Lentiviral Transduction Particles
DNA nucleotidylexotransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1098s21c1
Sequence:CCGGGCCGTCAGTGTGCTGGTTAAACTCGAGTTTAACCAGCACACTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-907s21c1
Sequence:CCGGATCAATCCTTCAAACTCTTTACTCGAGTAAAGAGTTTGAAGGATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004088.3-1863s21c1
Sequence:CCGGGGTAATGGGTAAGGTTCTAATCTCGAGATTAGAACCTTACCCATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1699s21c1
Sequence:CCGGAGGAAAGTGTTGTCAACATTTCTCGAGAAATGTTGACAACACTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004088.3-1302s21c1
Sequence:CCGGGACCTTGTGGAGTCAACATTTCTCGAGAAATGTTGACTCCACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-914s1c1
Sequence:CCGGGCAGGATTTCTGTATTATGAACTCGAGTTCATAATACAGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1528s1c1
Sequence:CCGGGCATCTGGGATTGGATTATATCTCGAGATATAATCCAATCCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-902s1c1
Sequence:CCGGCGAATGCAGAAAGCAGGATTTCTCGAGAAATCCTGCTTTCTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-538s1c1
Sequence:CCGGCCAGATATTCACGGATGCCTTCTCGAGAAGGCATCCGTGAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004088.2-1328s1c1
Sequence:CCGGGCCATCCGTGTGGATTTAGTTCTCGAGAACTAAATCCACACGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009345
DNTT MISSION shRNA Bacterial Glycerol Stock
DNA nucleotidylexotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009345.1-1793s1c1
Sequence:CCGGGCAACTTTGAAGTCTTGATAACTCGAGTTATCAAGACTTCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1186s1c1
Sequence:CCGGGACATCTTAGAGTCAACCTTTCTCGAGAAAGGTTGACTCTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1069s1c1
Sequence:CCGGACTGGACATGATGTAGACTTTCTCGAGAAAGTCTACATCATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-148s1c1
Sequence:CCGGCGAGACTTGGTCCTCTTCATTCTCGAGAATGAAGAGGACCAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-516s1c1
Sequence:CCGGCCAGCGAAGAACCACATTAAACTCGAGTTTAATGTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009345
DNTT MISSION shRNA shRNA Plasmid DNA
DNA nucleotidylexotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009345.1-1793s1c1
Sequence:CCGGGCAACTTTGAAGTCTTGATAACTCGAGTTATCAAGACTTCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1186s1c1
Sequence:CCGGGACATCTTAGAGTCAACCTTTCTCGAGAAAGGTTGACTCTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1069s1c1
Sequence:CCGGACTGGACATGATGTAGACTTTCTCGAGAAAGTCTACATCATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-148s1c1
Sequence:CCGGCGAGACTTGGTCCTCTTCATTCTCGAGAATGAAGAGGACCAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-516s1c1
Sequence:CCGGCCAGCGAAGAACCACATTAAACTCGAGTTTAATGTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009345
DNTT MISSION shRNA Lentiviral Transduction Particles
DNA nucleotidylexotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009345.1-1793s1c1
Sequence:CCGGGCAACTTTGAAGTCTTGATAACTCGAGTTATCAAGACTTCAAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1186s1c1
Sequence:CCGGGACATCTTAGAGTCAACCTTTCTCGAGAAAGGTTGACTCTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-1069s1c1
Sequence:CCGGACTGGACATGATGTAGACTTTCTCGAGAAAGTCTACATCATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-148s1c1
Sequence:CCGGCGAGACTTGGTCCTCTTCATTCTCGAGAATGAAGAGGACCAAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009345.1-516s1c1
Sequence:CCGGCCAGCGAAGAACCACATTAAACTCGAGTTTAATGTGGTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks