EMAIL THIS PAGE TO A FRIEND

DNTTIP1

deoxynucleotidyltransferase, terminal, interacting protein 1

Synonyms: C20orf167 Tdif1 dJ447F3.4
UniProtKB ID: Q9H147, B2RA18, Q96DE3, Q9BQP2, Q9H148
Gene ID:
Human(116092) Summary: DNTTIP1 binds DNA and enhances the activity of terminal deoxynucleotidyltransferase (TDT, or DNTT; MIM 187410), a DNA polymerase that catalyzes the polymerization of DNA in the absence of a DNA template (Yamashita et al., 2001 [PubMed 11473582]
Mouse(76233) deoxynucleotidyltransferase, terminal, interacting protein 1
Rat(171437) deoxynucleotidyltransferase, terminal, interacting protein 1
chicken(431225) deoxynucleotidyltransferase, terminal, interacting protein 1
dog(477246) deoxynucleotidyltransferase, terminal, interacting protein 1
Horse(100071090) deoxynucleotidyltransferase, terminal, interacting protein 1
cow(505524) deoxynucleotidyltransferase, terminal, interacting protein 1
domestic cat(101087652) deoxynucleotidyltransferase, terminal, interacting protein 1
domestic guinea pig(100718102) deoxynucleotidyltransferase, terminal, interacting protein 1
naked mole-rat(101724953) deoxynucleotidyltransferase, terminal, interacting protein 1
sheep(101114798) deoxynucleotidyltransferase, terminal, interacting protein 1
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052951 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052951 Rosetta Predictions human pricing
NM_134400 Rosetta Predictions rat pricing
XM_001072013 Rosetta Predictions rat pricing
XM_579637 Rosetta Predictions rat pricing
NM_133763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066757 predicted 1017
2 SASI_Hs01_00066758 predicted 347
3 SASI_Hs01_00066759 predicted 475
4 SASI_Hs01_00066760 predicted 679
5 SASI_Hs01_00066761 predicted 884
6 SASI_Hs01_00066762 predicted 1004
7 SASI_Hs01_00066763 predicted 300
8 SASI_Hs01_00066766 predicted 848
9 SASI_Hs02_00361749 predicted 864
10 SASI_Hs02_00361750 predicted 255
11 SASI_Hs01_00066764 predicted 994
12 SASI_Hs01_00066765 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046220 predicted 456
2 SASI_Rn02_00267977 predicted 556
3 SASI_Rn02_00267978 predicted 292
4 SASI_Rn02_00267979 predicted 207
5 SASI_Rn02_00267980 predicted 940
6 SASI_Rn02_00267981 predicted 701
7 SASI_Rn01_00046226 predicted 844
8 SASI_Rn02_00267982 predicted 1001
9 SASI_Rn02_00267983 predicted 898
10 SASI_Rn02_00267984 predicted 376
11 SASI_Rn01_00046221 predicted 1776
12 SASI_Rn01_00046222 predicted 1573
13 SASI_Rn01_00046223 predicted 1784
14 SASI_Rn01_00046224 predicted 314
15 SASI_Rn01_00046225 predicted 1441
16 SASI_Rn01_00046227 predicted 1034
17 SASI_Rn01_00046228 predicted 1830
18 SASI_Rn01_00046229 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337374 predicted 1132
2 SASI_Rn02_00337375 predicted 467
3 SASI_Rn02_00337376 predicted 667
4 SASI_Rn02_00337377 predicted 563
5 SASI_Rn02_00337378 predicted 702
6 SASI_Rn02_00337379 predicted 842
7 SASI_Rn02_00337380 predicted 1123
8 SASI_Rn02_00337381 predicted 211
9 SASI_Rn02_00337382 predicted 215
10 SASI_Rn02_00337383 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408606 predicted 460
2 SASI_Rn02_00408607 predicted 563
3 SASI_Rn02_00408608 predicted 295
4 SASI_Rn02_00408609 predicted 208
5 SASI_Rn02_00408610 predicted 952
6 SASI_Rn02_00408611 predicted 701
7 SASI_Rn02_00408612 predicted 845
8 SASI_Rn02_00408613 predicted 1006
9 SASI_Rn02_00408614 predicted 907
10 SASI_Rn02_00408615 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158439 predicted 276
2 SASI_Mm01_00158440 predicted 444
3 SASI_Mm01_00158441 predicted 829
4 SASI_Mm02_00338762 predicted 885
5 SASI_Mm01_00158442 predicted 326
6 SASI_Mm02_00338763 predicted 582
7 SASI_Mm01_00158443 predicted 646
8 SASI_Mm01_00158444 predicted 932
9 SASI_Mm01_00158445 predicted 813
10 SASI_Mm01_00158447 predicted 749
11 SASI_Mm01_00158446 predicted 551
12 SASI_Mm01_00158448 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052951
VALIDATED
DNTTIP1 MISSION shRNA Bacterial Glycerol Stock
deoxynucleotidyltransferase, terminal, interacting protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-176s1c1
Sequence:CCGGCCCTTGGAACATAATGATAAACTCGAGTTTATCATTATGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052951.2-686s1c1
Sequence:CCGGCCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-314s1c1
Sequence:CCGGCCAGACTGTCTTCAACAAGTACTCGAGTACTTGTTGAAGACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-933s1c1
Sequence:CCGGCTGAAGCTAGAGGAATTGAAACTCGAGTTTCAATTCCTCTAGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052951.2-435s1c1
Sequence:CCGGGAGCAGGCTAAACTGCTCTTTCTCGAGAAAGAGCAGTTTAGCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052951.2-897s21c1
Sequence:CCGGCTTGCGGCCAGTGATGATTACCTCGAGGTAATCATCACTGGCCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-488s21c1
Sequence:CCGGCCATGAGCTTCCAGGAATAAACTCGAGTTTATTCCTGGAAGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-769s21c1
Sequence:CCGGTCAAGCACCCACACCTCTTTACTCGAGTAAAGAGGTGTGGGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-1145s21c1
Sequence:CCGGATGGATCTCAGCGGCATTAAGCTCGAGCTTAATGCCGCTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-169s21c1
Sequence:CCGGTTACGAACCCTTGGAACATAACTCGAGTTATGTTCCAAGGGTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-228s21c1
Sequence:CCGGTCACAGATGACAACAAGTTTCCTCGAGGAAACTTGTTGTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-358s21c1
Sequence:CCGGCACTGAACGTGCGAGACAATGCTCGAGCATTGTCTCGCACGTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052951
VALIDATED
DNTTIP1 MISSION shRNA shRNA Plasmid DNA
deoxynucleotidyltransferase, terminal, interacting protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-176s1c1
Sequence:CCGGCCCTTGGAACATAATGATAAACTCGAGTTTATCATTATGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052951.2-686s1c1
Sequence:CCGGCCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-314s1c1
Sequence:CCGGCCAGACTGTCTTCAACAAGTACTCGAGTACTTGTTGAAGACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-933s1c1
Sequence:CCGGCTGAAGCTAGAGGAATTGAAACTCGAGTTTCAATTCCTCTAGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052951.2-435s1c1
Sequence:CCGGGAGCAGGCTAAACTGCTCTTTCTCGAGAAAGAGCAGTTTAGCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052951.2-897s21c1
Sequence:CCGGCTTGCGGCCAGTGATGATTACCTCGAGGTAATCATCACTGGCCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-488s21c1
Sequence:CCGGCCATGAGCTTCCAGGAATAAACTCGAGTTTATTCCTGGAAGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-769s21c1
Sequence:CCGGTCAAGCACCCACACCTCTTTACTCGAGTAAAGAGGTGTGGGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-1145s21c1
Sequence:CCGGATGGATCTCAGCGGCATTAAGCTCGAGCTTAATGCCGCTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-169s21c1
Sequence:CCGGTTACGAACCCTTGGAACATAACTCGAGTTATGTTCCAAGGGTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-228s21c1
Sequence:CCGGTCACAGATGACAACAAGTTTCCTCGAGGAAACTTGTTGTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-358s21c1
Sequence:CCGGCACTGAACGTGCGAGACAATGCTCGAGCATTGTCTCGCACGTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052951
VALIDATED
DNTTIP1 MISSION shRNA Lentiviral Transduction Particles
deoxynucleotidyltransferase, terminal, interacting protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-176s1c1
Sequence:CCGGCCCTTGGAACATAATGATAAACTCGAGTTTATCATTATGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052951.2-686s1c1
Sequence:CCGGCCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-314s1c1
Sequence:CCGGCCAGACTGTCTTCAACAAGTACTCGAGTACTTGTTGAAGACAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_052951.2-933s1c1
Sequence:CCGGCTGAAGCTAGAGGAATTGAAACTCGAGTTTCAATTCCTCTAGCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052951.2-435s1c1
Sequence:CCGGGAGCAGGCTAAACTGCTCTTTCTCGAGAAAGAGCAGTTTAGCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052951.2-897s21c1
Sequence:CCGGCTTGCGGCCAGTGATGATTACCTCGAGGTAATCATCACTGGCCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-488s21c1
Sequence:CCGGCCATGAGCTTCCAGGAATAAACTCGAGTTTATTCCTGGAAGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-769s21c1
Sequence:CCGGTCAAGCACCCACACCTCTTTACTCGAGTAAAGAGGTGTGGGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-1145s21c1
Sequence:CCGGATGGATCTCAGCGGCATTAAGCTCGAGCTTAATGCCGCTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-169s21c1
Sequence:CCGGTTACGAACCCTTGGAACATAACTCGAGTTATGTTCCAAGGGTTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-228s21c1
Sequence:CCGGTCACAGATGACAACAAGTTTCCTCGAGGAAACTTGTTGTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052951.2-358s21c1
Sequence:CCGGCACTGAACGTGCGAGACAATGCTCGAGCATTGTCTCGCACGTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133763
DNTTIP1 MISSION shRNA Bacterial Glycerol Stock
deoxynucleotidyltransferase, terminal, interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133763.1-1104s1c1
Sequence:CCGGGATTTGGTCTAGTTGACTCTTCTCGAGAAGAGTCAACTAGACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-328s1c1
Sequence:CCGGGCGCTGAATGTGCGAGACAATCTCGAGATTGTCTCGCACATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-741s1c1
Sequence:CCGGGCACCCACACCTCTTTAAGTACTCGAGTACTTAAAGAGGTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-654s1c1
Sequence:CCGGGCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-876s1c1
Sequence:CCGGCGATGACTACAGAGGATGCTTCTCGAGAAGCATCCTCTGTAGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133763
DNTTIP1 MISSION shRNA shRNA Plasmid DNA
deoxynucleotidyltransferase, terminal, interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133763.1-1104s1c1
Sequence:CCGGGATTTGGTCTAGTTGACTCTTCTCGAGAAGAGTCAACTAGACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-328s1c1
Sequence:CCGGGCGCTGAATGTGCGAGACAATCTCGAGATTGTCTCGCACATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-741s1c1
Sequence:CCGGGCACCCACACCTCTTTAAGTACTCGAGTACTTAAAGAGGTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-654s1c1
Sequence:CCGGGCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-876s1c1
Sequence:CCGGCGATGACTACAGAGGATGCTTCTCGAGAAGCATCCTCTGTAGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133763
DNTTIP1 MISSION shRNA Lentiviral Transduction Particles
deoxynucleotidyltransferase, terminal, interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133763.1-1104s1c1
Sequence:CCGGGATTTGGTCTAGTTGACTCTTCTCGAGAAGAGTCAACTAGACCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-328s1c1
Sequence:CCGGGCGCTGAATGTGCGAGACAATCTCGAGATTGTCTCGCACATTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-741s1c1
Sequence:CCGGGCACCCACACCTCTTTAAGTACTCGAGTACTTAAAGAGGTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-654s1c1
Sequence:CCGGGCTGAATGAATCTACCACCTTCTCGAGAAGGTGGTAGATTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133763.1-876s1c1
Sequence:CCGGCGATGACTACAGAGGATGCTTCTCGAGAAGCATCCTCTGTAGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks