EMAIL THIS PAGE TO A FRIEND

DNTTIP2

deoxynucleotidyltransferase, terminal, interacting protein 2

Synonyms: ERBP FCF2 HSU15552 LPTS-RP2 TdIF2
Gene ID:
Human(30836) Summary: This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Mouse(99480) deoxynucleotidyltransferase, terminal, interacting protein 2
Rat(295419) deoxynucleotidyltransferase, terminal, interacting protein 2
sheep(101107316) deoxynucleotidyltransferase, terminal, interacting protein 2
Domestic Rabbit(100351927) deoxynucleotidyltransferase, terminal, interacting protein 2
naked mole-rat(101725866) deoxynucleotidyltransferase, terminal, interacting protein 2
domestic guinea pig(100718271) deoxynucleotidyltransferase, terminal, interacting protein 2
Zebrafish(564961) deoxynucleotidyltransferase, terminal, interacting protein 2
chicken(424493) deoxynucleotidyltransferase, terminal, interacting protein 2
cow(511258) deoxynucleotidyltransferase, terminal, interacting protein 2
Horse(100630803) deoxynucleotidyltransferase, terminal, interacting protein 2
domestic cat(101081317) deoxynucleotidyltransferase, terminal, interacting protein 2
dog(490154) deoxynucleotidyltransferase, terminal, interacting protein 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049361 MISSION® esiRNA esiRNA human DNTTIP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014597 Rosetta Predictions human pricing
XM_215688 Rosetta Predictions rat pricing
XR_008991 Rosetta Predictions rat pricing
NM_153806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114005 predicted 1894
2 SASI_Hs01_00114006 predicted 1267
3 SASI_Hs01_00114007 predicted 1352
4 SASI_Hs01_00114008 predicted 266
5 SASI_Hs01_00114009 predicted 756
6 SASI_Hs01_00114010 predicted 424
7 SASI_Hs01_00114011 predicted 1011
8 SASI_Hs01_00114012 predicted 1270
9 SASI_Hs01_00114013 predicted 1077
10 SASI_Hs01_00114014 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140736 predicted 511
2 SASI_Rn01_00140737 predicted 784
3 SASI_Rn01_00140738 predicted 1122
4 SASI_Rn01_00140739 predicted 292
5 SASI_Rn01_00140740 predicted 1717
6 SASI_Rn01_00140741 predicted 896
7 SASI_Rn01_00140742 predicted 975
8 SASI_Rn01_00140743 predicted 1049
9 SASI_Rn01_00140744 predicted 905
10 SASI_Rn01_00140745 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155277 predicted 527
2 SASI_Rn02_00418424 predicted 1929
3 SASI_Rn01_00155278 predicted 795
4 SASI_Rn01_00155279 predicted 1132
5 SASI_Rn01_00155280 predicted 312
6 SASI_Rn01_00155281 predicted 914
7 SASI_Rn01_00155282 predicted 1353
8 SASI_Rn01_00155283 predicted 999
9 SASI_Rn01_00155284 predicted 1059
10 SASI_Rn01_00155285 predicted 928
11 SASI_Rn01_00155276 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066448 predicted 1956
2 SASI_Mm01_00066449 predicted 1929
3 SASI_Mm01_00066450 predicted 735
4 SASI_Mm01_00066451 predicted 1855
5 SASI_Mm01_00066452 predicted 1654
6 SASI_Mm01_00066453 predicted 854
7 SASI_Mm01_00066454 predicted 2096
8 SASI_Mm01_00066455 predicted 289
9 SASI_Mm01_00066456 predicted 654
10 SASI_Mm01_00066457 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014597
VALIDATED
DNTTIP2 MISSION shRNA Bacterial Glycerol Stock
deoxynucleotidyltransferase, terminal, interacting protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-798s21c1
Sequence:CCGGGAGATAAATAAGCCAAATTTCCTCGAGGAAATTTGGCTTATTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1750s21c1
Sequence:CCGGAGCAGTTGGGTGGTTTGTATACTCGAGTATACAAACCACCCAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1445s21c1
Sequence:CCGGTGGCCAAAGGGAGTCATTAAGCTCGAGCTTAATGACTCCCTTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-208s21c1
Sequence:CCGGTAATCCCTAGAACTCCTAAAGCTCGAGCTTTAGGAGTTCTAGGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1856s21c1
Sequence:CCGGAGCCGTCATTACACCTGATTTCTCGAGAAATCAGGTGTAATGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1336s21c1
Sequence:CCGGCATCTCAGGGTAAAGATAATTCTCGAGAATTATCTTTACCCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1298s21c1
Sequence:CCGGTGAATGTGATACCAAACTATACTCGAGTATAGTTTGGTATCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-399s1c1
Sequence:CCGGGCCGAAAGTAACTCCAACAAACTCGAGTTTGTTGGAGTTACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-1668s1c1
Sequence:CCGGCCTAAATAGCACAAAGGCTAACTCGAGTTAGCCTTTGTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-874s1c1
Sequence:CCGGGCCAATGTTGAATCTCTTAAACTCGAGTTTAAGAGATTCAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-1972s1c1
Sequence:CCGGGCTCCAGAAATGACAAATGAACTCGAGTTCATTTGTCATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-74s1c1
Sequence:CCGGCGGCTGAAAGTTCCGGGCAAACTCGAGTTTGCCCGGAACTTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014597
VALIDATED
DNTTIP2 MISSION shRNA shRNA Plasmid DNA
deoxynucleotidyltransferase, terminal, interacting protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-798s21c1
Sequence:CCGGGAGATAAATAAGCCAAATTTCCTCGAGGAAATTTGGCTTATTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1750s21c1
Sequence:CCGGAGCAGTTGGGTGGTTTGTATACTCGAGTATACAAACCACCCAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1445s21c1
Sequence:CCGGTGGCCAAAGGGAGTCATTAAGCTCGAGCTTAATGACTCCCTTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-208s21c1
Sequence:CCGGTAATCCCTAGAACTCCTAAAGCTCGAGCTTTAGGAGTTCTAGGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1856s21c1
Sequence:CCGGAGCCGTCATTACACCTGATTTCTCGAGAAATCAGGTGTAATGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1336s21c1
Sequence:CCGGCATCTCAGGGTAAAGATAATTCTCGAGAATTATCTTTACCCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1298s21c1
Sequence:CCGGTGAATGTGATACCAAACTATACTCGAGTATAGTTTGGTATCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-399s1c1
Sequence:CCGGGCCGAAAGTAACTCCAACAAACTCGAGTTTGTTGGAGTTACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-1668s1c1
Sequence:CCGGCCTAAATAGCACAAAGGCTAACTCGAGTTAGCCTTTGTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-874s1c1
Sequence:CCGGGCCAATGTTGAATCTCTTAAACTCGAGTTTAAGAGATTCAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-1972s1c1
Sequence:CCGGGCTCCAGAAATGACAAATGAACTCGAGTTCATTTGTCATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-74s1c1
Sequence:CCGGCGGCTGAAAGTTCCGGGCAAACTCGAGTTTGCCCGGAACTTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014597
VALIDATED
DNTTIP2 MISSION shRNA Lentiviral Transduction Particles
deoxynucleotidyltransferase, terminal, interacting protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-798s21c1
Sequence:CCGGGAGATAAATAAGCCAAATTTCCTCGAGGAAATTTGGCTTATTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1750s21c1
Sequence:CCGGAGCAGTTGGGTGGTTTGTATACTCGAGTATACAAACCACCCAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1445s21c1
Sequence:CCGGTGGCCAAAGGGAGTCATTAAGCTCGAGCTTAATGACTCCCTTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-208s21c1
Sequence:CCGGTAATCCCTAGAACTCCTAAAGCTCGAGCTTTAGGAGTTCTAGGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1856s21c1
Sequence:CCGGAGCCGTCATTACACCTGATTTCTCGAGAAATCAGGTGTAATGACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1336s21c1
Sequence:CCGGCATCTCAGGGTAAAGATAATTCTCGAGAATTATCTTTACCCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014597.3-1298s21c1
Sequence:CCGGTGAATGTGATACCAAACTATACTCGAGTATAGTTTGGTATCACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-399s1c1
Sequence:CCGGGCCGAAAGTAACTCCAACAAACTCGAGTTTGTTGGAGTTACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-1668s1c1
Sequence:CCGGCCTAAATAGCACAAAGGCTAACTCGAGTTAGCCTTTGTGCTATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-874s1c1
Sequence:CCGGGCCAATGTTGAATCTCTTAAACTCGAGTTTAAGAGATTCAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014597.1-1972s1c1
Sequence:CCGGGCTCCAGAAATGACAAATGAACTCGAGTTCATTTGTCATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014597.1-74s1c1
Sequence:CCGGCGGCTGAAAGTTCCGGGCAAACTCGAGTTTGCCCGGAACTTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153806
DNTTIP2 MISSION shRNA Bacterial Glycerol Stock
deoxynucleotidyltransferase, terminal, interacting protein 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-956s21c1
Sequence:CCGGAGATTCCCAGCGGAGTCTTTCCTCGAGGAAAGACTCCGCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-196s21c1
Sequence:CCGGCGGAGATCATTGTGCTTATTTCTCGAGAAATAAGCACAATGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-688s21c1
Sequence:CCGGACTCAGATGCTACTCAGTTATCTCGAGATAACTGAGTAGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-1064s21c1
Sequence:CCGGTCCAGATCGGAAGGCTCTAATCTCGAGATTAGAGCCTTCCGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-303s21c1
Sequence:CCGGAGGAAACGGCAGATCGTAATTCTCGAGAATTACGATCTGCCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-2104s1c1
Sequence:CCGGCCGACTTCTACCATTCACGAACTCGAGTTCGTGAATGGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-1318s1c1
Sequence:CCGGCGGACAGTCCTGTCTTATTATCTCGAGATAATAAGACAGGACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153806
DNTTIP2 MISSION shRNA shRNA Plasmid DNA
deoxynucleotidyltransferase, terminal, interacting protein 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-956s21c1
Sequence:CCGGAGATTCCCAGCGGAGTCTTTCCTCGAGGAAAGACTCCGCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-196s21c1
Sequence:CCGGCGGAGATCATTGTGCTTATTTCTCGAGAAATAAGCACAATGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-688s21c1
Sequence:CCGGACTCAGATGCTACTCAGTTATCTCGAGATAACTGAGTAGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-1064s21c1
Sequence:CCGGTCCAGATCGGAAGGCTCTAATCTCGAGATTAGAGCCTTCCGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-303s21c1
Sequence:CCGGAGGAAACGGCAGATCGTAATTCTCGAGAATTACGATCTGCCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-2104s1c1
Sequence:CCGGCCGACTTCTACCATTCACGAACTCGAGTTCGTGAATGGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-1318s1c1
Sequence:CCGGCGGACAGTCCTGTCTTATTATCTCGAGATAATAAGACAGGACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153806
DNTTIP2 MISSION shRNA Lentiviral Transduction Particles
deoxynucleotidyltransferase, terminal, interacting protein 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-956s21c1
Sequence:CCGGAGATTCCCAGCGGAGTCTTTCCTCGAGGAAAGACTCCGCTGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-196s21c1
Sequence:CCGGCGGAGATCATTGTGCTTATTTCTCGAGAAATAAGCACAATGATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-688s21c1
Sequence:CCGGACTCAGATGCTACTCAGTTATCTCGAGATAACTGAGTAGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-1064s21c1
Sequence:CCGGTCCAGATCGGAAGGCTCTAATCTCGAGATTAGAGCCTTCCGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153806.1-303s21c1
Sequence:CCGGAGGAAACGGCAGATCGTAATTCTCGAGAATTACGATCTGCCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-2104s1c1
Sequence:CCGGCCGACTTCTACCATTCACGAACTCGAGTTCGTGAATGGTAGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153806.1-1318s1c1
Sequence:CCGGCGGACAGTCCTGTCTTATTATCTCGAGATAATAAGACAGGACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks