EMAIL THIS PAGE TO A FRIEND

DOC2A

double C2-like domains, alpha

78 Gene Product Result for
Synonyms: Doc2
UniProtKB ID: Q14183, Q6P4G4, Q7Z5G0, Q8IVX0
Gene ID:
Human(8448) Summary: There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2A is mainly expressed in brain and is suggested to be involved in Ca(2+)-dependent neurotransmitter release. [provided by RefSeq, Jul 2008]
Mouse(13446) double C2, alpha
Rat(65031) double C2-like domains, alpha
cow(528120) double C2-like domains, alpha
Horse(100066024) double C2-like domains, alpha
dog(489945) double C2-like domains, alpha
domestic cat(101100270) double C2-like domains, alpha
sheep(101116792) double C2-like domains, alpha
domestic guinea pig(100731235) double C2-like domains, alpha
naked mole-rat(101706673) double C2-like domains, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003586 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087791 MISSION® esiRNA esiRNA human DOC2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003586 Rosetta Predictions human pricing
NM_022937 Rosetta Predictions rat pricing
NM_010069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011961 predicted 881
2 SASI_Hs01_00011962 predicted 789
3 SASI_Hs01_00011963 predicted 1453
4 SASI_Hs01_00011965 predicted 1118
5 SASI_Hs01_00011966 predicted 1126
6 SASI_Hs01_00011967 predicted 630
7 SASI_Hs01_00011968 predicted 664
8 SASI_Hs01_00011969 predicted 630
9 SASI_Hs01_00011970 predicted 601
10 SASI_Hs02_00335908 predicted 662
11 SASI_Hs01_00011964 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034048 predicted 342
2 SASI_Rn02_00263643 predicted 621
3 SASI_Rn01_00034049 predicted 545
4 SASI_Rn01_00034050 predicted 346
5 SASI_Rn01_00034051 predicted 503
6 SASI_Rn01_00034052 predicted 528
7 SASI_Rn01_00034053 predicted 1109
8 SASI_Rn01_00034054 predicted 1007
9 SASI_Rn01_00034055 predicted 539
10 SASI_Rn01_00034056 predicted 369
11 SASI_Rn01_00034057 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062535 predicted 941
2 SASI_Mm01_00062536 predicted 1558
3 SASI_Mm01_00062537 predicted 1497
4 SASI_Mm01_00062538 predicted 1597
5 SASI_Mm01_00062539 predicted 1622
6 SASI_Mm01_00062540 predicted 1609
7 SASI_Mm01_00062541 predicted 1758
8 SASI_Mm01_00062542 predicted 1131
9 SASI_Mm01_00062543 predicted 1021
10 SASI_Mm01_00062544 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010069
DOC2A MISSION shRNA Bacterial Glycerol Stock
double C2-like domains, alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1714s1c1
Sequence:CCGGGACTTCATAGGTGGTGTGTCTCTCGAGAGACACACCACCTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1497s1c1
Sequence:CCGGCCTGGCTGCAATGGATGTTAACTCGAGTTAACATCCATTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010069.1-2384s1c1
Sequence:CCGGCCACTCGTTTAAATAACTGTTCTCGAGAACAGTTATTTAAACGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1011s1c1
Sequence:CCGGCCTCAAGCCCATGGATTTCAACTCGAGTTGAAATCCATGGGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1189s1c1
Sequence:CCGGCTCAGGATCTCTGTCTGTGATCTCGAGATCACAGACAGAGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1564s1c1
Sequence:CCGGGATAAGAAATCCAAGCACAAACTCGAGTTTGTGCTTGGATTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1530s1c1
Sequence:CCGGCCCTTATGTGAAGACGTACTTCTCGAGAAGTACGTCTTCACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010069
DOC2A MISSION shRNA shRNA Plasmid DNA
double C2-like domains, alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1714s1c1
Sequence:CCGGGACTTCATAGGTGGTGTGTCTCTCGAGAGACACACCACCTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1497s1c1
Sequence:CCGGCCTGGCTGCAATGGATGTTAACTCGAGTTAACATCCATTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010069.1-2384s1c1
Sequence:CCGGCCACTCGTTTAAATAACTGTTCTCGAGAACAGTTATTTAAACGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1011s1c1
Sequence:CCGGCCTCAAGCCCATGGATTTCAACTCGAGTTGAAATCCATGGGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1189s1c1
Sequence:CCGGCTCAGGATCTCTGTCTGTGATCTCGAGATCACAGACAGAGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1564s1c1
Sequence:CCGGGATAAGAAATCCAAGCACAAACTCGAGTTTGTGCTTGGATTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1530s1c1
Sequence:CCGGCCCTTATGTGAAGACGTACTTCTCGAGAAGTACGTCTTCACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010069
DOC2A MISSION shRNA Lentiviral Transduction Particles
double C2-like domains, alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1714s1c1
Sequence:CCGGGACTTCATAGGTGGTGTGTCTCTCGAGAGACACACCACCTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1497s1c1
Sequence:CCGGCCTGGCTGCAATGGATGTTAACTCGAGTTAACATCCATTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010069.1-2384s1c1
Sequence:CCGGCCACTCGTTTAAATAACTGTTCTCGAGAACAGTTATTTAAACGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1011s1c1
Sequence:CCGGCCTCAAGCCCATGGATTTCAACTCGAGTTGAAATCCATGGGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1189s1c1
Sequence:CCGGCTCAGGATCTCTGTCTGTGATCTCGAGATCACAGACAGAGATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010069.1-1564s1c1
Sequence:CCGGGATAAGAAATCCAAGCACAAACTCGAGTTTGTGCTTGGATTTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010069.1-1530s1c1
Sequence:CCGGCCCTTATGTGAAGACGTACTTCTCGAGAAGTACGTCTTCACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003586
VALIDATED
DOC2A MISSION shRNA Bacterial Glycerol Stock
double C2-like domains, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-1058s1c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-656s1c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-350s1c1
Sequence:CCGGGACAGCTATGACTCGGATGATCTCGAGATCATCCGAGTCATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-1024s1c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-808s1c1
Sequence:CCGGCTCCTGTTATCTGAAGGACTTCTCGAGAAGTCCTTCAGATAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-596s21c1
Sequence:CCGGTGGAGCCTGTAAGGCCAATAACTCGAGTTATTGGCCTTACAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1103s21c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1137s21c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-735s21c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003586
VALIDATED
DOC2A MISSION shRNA shRNA Plasmid DNA
double C2-like domains, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-1058s1c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-656s1c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-350s1c1
Sequence:CCGGGACAGCTATGACTCGGATGATCTCGAGATCATCCGAGTCATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-1024s1c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-808s1c1
Sequence:CCGGCTCCTGTTATCTGAAGGACTTCTCGAGAAGTCCTTCAGATAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-596s21c1
Sequence:CCGGTGGAGCCTGTAAGGCCAATAACTCGAGTTATTGGCCTTACAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1103s21c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1137s21c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-735s21c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003586
VALIDATED
DOC2A MISSION shRNA Lentiviral Transduction Particles
double C2-like domains, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-1058s1c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-656s1c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-350s1c1
Sequence:CCGGGACAGCTATGACTCGGATGATCTCGAGATCATCCGAGTCATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003586.1-1024s1c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003586.1-808s1c1
Sequence:CCGGCTCCTGTTATCTGAAGGACTTCTCGAGAAGTCCTTCAGATAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-596s21c1
Sequence:CCGGTGGAGCCTGTAAGGCCAATAACTCGAGTTATTGGCCTTACAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1103s21c1
Sequence:CCGGGCATAAGACGTGTGTGAAGAACTCGAGTTCTTCACACACGTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-1137s21c1
Sequence:CCGGCCAGAATTTAACGAGGAGTTTCTCGAGAAACTCCTCGTTAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003586.2-735s21c1
Sequence:CCGGGAGGACAAGCTGAGTCACAATCTCGAGATTGTGACTCAGCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks