EMAIL THIS PAGE TO A FRIEND

DOC2B

double C2-like domains, beta

50 Gene Product Result for
Synonyms: DOC2BL
UniProtKB ID: Q14184
Gene ID:
Human(8447) Summary: There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2B is expressed ubiquitously and is suggested to be involved in Ca(2+)-dependent intracellular vesicle trafficking in various types of cells. [provided by RefSeq, Jul 2008]
Mouse(13447) double C2, beta
Rat(81820) double C2-like domains, beta
naked mole-rat(101716886) double C2-like domains, beta
domestic guinea pig(100719039) double C2-like domains, beta
sheep(101102501) double C2-like domains, beta
Zebrafish(100006713) double C2-like domains, beta
cow(785428) double C2-like domains, beta
domestic cat(101086354) double C2-like domains, beta
dog(611233) double C2-like domains, beta
chicken(417624) double C2-like domains, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003585 Rosetta Predictions human pricing
NM_031142 Rosetta Predictions rat pricing
NM_007873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167245 predicted 1125
2 SASI_Hs02_00335901 predicted 1027
3 SASI_Hs02_00335902 predicted 719
4 SASI_Hs02_00335903 predicted 872
5 SASI_Hs02_00335904 predicted 730
6 SASI_Hs01_00167246 predicted 1107
7 SASI_Hs01_00167247 predicted 1281
8 SASI_Hs02_00335905 predicted 738
9 SASI_Hs02_00335906 predicted 736
10 SASI_Hs02_00335907 predicted 866
11 SASI_Hs01_00167248 predicted 1203
12 SASI_Hs01_00167249 predicted 1144
13 SASI_Hs01_00167250 predicted 1212
14 SASI_Hs01_00167251 predicted 1390
15 SASI_Hs01_00167252 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100461 predicted 725
2 SASI_Rn01_00100462 predicted 1499
3 SASI_Rn01_00100463 predicted 1034
4 SASI_Rn02_00264479 predicted 1298
5 SASI_Rn01_00100464 predicted 1104
6 SASI_Rn01_00100465 predicted 738
7 SASI_Rn01_00100467 predicted 867
8 SASI_Rn01_00100468 predicted 1205
9 SASI_Rn01_00100469 predicted 618
10 SASI_Rn01_00100470 predicted 681
11 SASI_Rn01_00100466 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057963 predicted 1182
2 SASI_Mm01_00057964 predicted 874
3 SASI_Mm01_00057965 predicted 1297
4 SASI_Mm01_00057966 predicted 1822
5 SASI_Mm02_00312659 predicted 879
6 SASI_Mm01_00057967 predicted 1788
7 SASI_Mm01_00057968 predicted 1887
8 SASI_Mm02_00312660 predicted 871
9 SASI_Mm01_00057969 predicted 966
10 SASI_Mm01_00057970 predicted 1883
11 SASI_Mm01_00057971 predicted 883
12 SASI_Mm01_00057972 predicted 1661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003585
DOC2B MISSION shRNA Bacterial Glycerol Stock
double C2-like domains, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-729s21c1
Sequence:CCGGGAACGAGACCCTCACTTACTACTCGAGTAGTAAGTGAGGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-806s21c1
Sequence:CCGGAGGACAAATTCCGGCACAATGCTCGAGCATTGTGCCGGAATTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003585.1-1827s1c1
Sequence:CCGGCCCAAGAAAGCCTAACTGCATCTCGAGATGCAGTTAGGCTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1144s1c1
Sequence:CCGGCCCGGAGTTTAATGAGGAGTTCTCGAGAACTCCTCATTAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-244s1c1
Sequence:CCGGCAAGCAGATCTCCGACTACTTCTCGAGAAGTAGTCGGAGATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-754s1c1
Sequence:CCGGCGGGATCACAGATGAAGACATCTCGAGATGTCTTCATCTGTGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-877s1c1
Sequence:CCGGCCACACCAAGACCTTCAACATCTCGAGATGTTGAAGGTCTTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-556s1c1
Sequence:CCGGGCTGTATGACCAGGAGAACAACTCGAGTTGTTCTCCTGGTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-743s1c1
Sequence:CCGGCTCACTTACTACGGGATCACACTCGAGTGTGATCCCGTAGTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1107s1c1
Sequence:CCGGCCAAACATAAGACAGCGGTGACTCGAGTCACCGCTGTCTTATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003585
DOC2B MISSION shRNA shRNA Plasmid DNA
double C2-like domains, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-729s21c1
Sequence:CCGGGAACGAGACCCTCACTTACTACTCGAGTAGTAAGTGAGGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-806s21c1
Sequence:CCGGAGGACAAATTCCGGCACAATGCTCGAGCATTGTGCCGGAATTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003585.1-1827s1c1
Sequence:CCGGCCCAAGAAAGCCTAACTGCATCTCGAGATGCAGTTAGGCTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1144s1c1
Sequence:CCGGCCCGGAGTTTAATGAGGAGTTCTCGAGAACTCCTCATTAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-244s1c1
Sequence:CCGGCAAGCAGATCTCCGACTACTTCTCGAGAAGTAGTCGGAGATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-754s1c1
Sequence:CCGGCGGGATCACAGATGAAGACATCTCGAGATGTCTTCATCTGTGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-877s1c1
Sequence:CCGGCCACACCAAGACCTTCAACATCTCGAGATGTTGAAGGTCTTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-556s1c1
Sequence:CCGGGCTGTATGACCAGGAGAACAACTCGAGTTGTTCTCCTGGTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-743s1c1
Sequence:CCGGCTCACTTACTACGGGATCACACTCGAGTGTGATCCCGTAGTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1107s1c1
Sequence:CCGGCCAAACATAAGACAGCGGTGACTCGAGTCACCGCTGTCTTATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003585
DOC2B MISSION shRNA Lentiviral Transduction Particles
double C2-like domains, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-729s21c1
Sequence:CCGGGAACGAGACCCTCACTTACTACTCGAGTAGTAAGTGAGGGTCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003585.2-806s21c1
Sequence:CCGGAGGACAAATTCCGGCACAATGCTCGAGCATTGTGCCGGAATTTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003585.1-1827s1c1
Sequence:CCGGCCCAAGAAAGCCTAACTGCATCTCGAGATGCAGTTAGGCTTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1144s1c1
Sequence:CCGGCCCGGAGTTTAATGAGGAGTTCTCGAGAACTCCTCATTAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-244s1c1
Sequence:CCGGCAAGCAGATCTCCGACTACTTCTCGAGAAGTAGTCGGAGATCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-754s1c1
Sequence:CCGGCGGGATCACAGATGAAGACATCTCGAGATGTCTTCATCTGTGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-877s1c1
Sequence:CCGGCCACACCAAGACCTTCAACATCTCGAGATGTTGAAGGTCTTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-556s1c1
Sequence:CCGGGCTGTATGACCAGGAGAACAACTCGAGTTGTTCTCCTGGTCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003585.1-743s1c1
Sequence:CCGGCTCACTTACTACGGGATCACACTCGAGTGTGATCCCGTAGTAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003585.1-1107s1c1
Sequence:CCGGCCAAACATAAGACAGCGGTGACTCGAGTCACCGCTGTCTTATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007873
DOC2B MISSION shRNA Bacterial Glycerol Stock
double C2-like domains, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007873.2-1664s21c1
Sequence:CCGGATCTACAGTGAGGACCTATTGCTCGAGCAATAGGTCCTCACTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-743s21c1
Sequence:CCGGGAACGAGACCCTCACTTATTACTCGAGTAATAAGTGAGGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-1225s21c1
Sequence:CCGGCTGTCTGGGATTATGACATTGCTCGAGCAATGTCATAATCCCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-253s21c1
Sequence:CCGGTCAAGCAGATCTCCGATTATTCTCGAGAATAATCGGAGATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-1310s1c1
Sequence:CCGGGCACTGGTTTGACTGCTTGAACTCGAGTTCAAGCAGTCAAACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-983s1c1
Sequence:CCGGCCTCAAGTACAGCTCACAGAACTCGAGTTCTGTGAGCTGTACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-249s1c1
Sequence:CCGGCCTATCAAGCAGATCTCCGATCTCGAGATCGGAGATCTGCTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-819s1c1
Sequence:CCGGGAGGACAAATTCCGCCACAATCTCGAGATTGTGGCGGAATTTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-688s1c1
Sequence:CCGGGCAAGGCAAATAAGCTCAGAACTCGAGTTCTGAGCTTATTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007873
DOC2B MISSION shRNA shRNA Plasmid DNA
double C2-like domains, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007873.2-1664s21c1
Sequence:CCGGATCTACAGTGAGGACCTATTGCTCGAGCAATAGGTCCTCACTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-743s21c1
Sequence:CCGGGAACGAGACCCTCACTTATTACTCGAGTAATAAGTGAGGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-1225s21c1
Sequence:CCGGCTGTCTGGGATTATGACATTGCTCGAGCAATGTCATAATCCCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-253s21c1
Sequence:CCGGTCAAGCAGATCTCCGATTATTCTCGAGAATAATCGGAGATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-1310s1c1
Sequence:CCGGGCACTGGTTTGACTGCTTGAACTCGAGTTCAAGCAGTCAAACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-983s1c1
Sequence:CCGGCCTCAAGTACAGCTCACAGAACTCGAGTTCTGTGAGCTGTACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-249s1c1
Sequence:CCGGCCTATCAAGCAGATCTCCGATCTCGAGATCGGAGATCTGCTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-819s1c1
Sequence:CCGGGAGGACAAATTCCGCCACAATCTCGAGATTGTGGCGGAATTTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-688s1c1
Sequence:CCGGGCAAGGCAAATAAGCTCAGAACTCGAGTTCTGAGCTTATTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007873
DOC2B MISSION shRNA Lentiviral Transduction Particles
double C2-like domains, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007873.2-1664s21c1
Sequence:CCGGATCTACAGTGAGGACCTATTGCTCGAGCAATAGGTCCTCACTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-743s21c1
Sequence:CCGGGAACGAGACCCTCACTTATTACTCGAGTAATAAGTGAGGGTCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-1225s21c1
Sequence:CCGGCTGTCTGGGATTATGACATTGCTCGAGCAATGTCATAATCCCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007873.2-253s21c1
Sequence:CCGGTCAAGCAGATCTCCGATTATTCTCGAGAATAATCGGAGATCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-1310s1c1
Sequence:CCGGGCACTGGTTTGACTGCTTGAACTCGAGTTCAAGCAGTCAAACCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-983s1c1
Sequence:CCGGCCTCAAGTACAGCTCACAGAACTCGAGTTCTGTGAGCTGTACTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-249s1c1
Sequence:CCGGCCTATCAAGCAGATCTCCGATCTCGAGATCGGAGATCTGCTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-819s1c1
Sequence:CCGGGAGGACAAATTCCGCCACAATCTCGAGATTGTGGCGGAATTTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007873.2-688s1c1
Sequence:CCGGGCAAGGCAAATAAGCTCAGAACTCGAGTTCTGAGCTTATTTGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks