EMAIL THIS PAGE TO A FRIEND

DOCK10

dedicator of cytokinesis 10

108 Gene Product Result for
Synonyms: DRIP2 Nbla10300 ZIZ3
UniProtKB ID: Q96BY6, O75178, Q9NW06, Q9NXI8
Gene ID:
Mouse(210293) dedicator of cytokinesis 10
sheep(101123187) dedicator of cytokinesis 10
naked mole-rat(101725765) dedicator of cytokinesis 10
domestic guinea pig(100732866) dedicator of cytokinesis 10
Zebrafish(100000949) dedicator of cytokinesis 10
cow(539421) dedicator of cytokinesis 10
Horse(100061558) dedicator of cytokinesis 10
domestic cat(101086588) dedicator of cytokinesis 10
dog(100684934) dedicator of cytokinesis 10
chicken(424803) dedicator of cytokinesis 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014689 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216031 MISSION® esiRNA esiRNA targeting mouse Dock10 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014689 Rosetta Predictions human pricing
NM_175291 Rosetta Predictions mouse pricing
XM_891407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124646 predicted 6080
2 SASI_Hs02_00346061 predicted 2663
3 SASI_Hs01_00124648 predicted 6715
4 SASI_Hs01_00124650 predicted 5097
5 SASI_Hs01_00124652 predicted 5982
6 SASI_Hs01_00124653 predicted 6319
7 SASI_Hs02_00346062 predicted 1787
8 SASI_Hs01_00124654 predicted 4871
9 SASI_Hs01_00124655 predicted 5702
10 SASI_Hs02_00346063 predicted 6539
11 SASI_Hs01_00124647 predicted 596
12 SASI_Hs01_00124649 predicted 2915
13 SASI_Hs01_00124651 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346031 predicted 860
2 SASI_Mm02_00346032 predicted 3273
3 SASI_Mm02_00346033 predicted 4241
4 SASI_Mm02_00346034 predicted 5056
5 SASI_Mm02_00346035 predicted 5569
6 SASI_Mm02_00346036 predicted 2087
7 SASI_Mm02_00346037 predicted 1332
8 SASI_Mm02_00346038 predicted 4414
9 SASI_Mm02_00346039 predicted 5291
10 SASI_Mm02_00346040 predicted 5271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213555 predicted 3705
2 SASI_Mm01_00213556 predicted 4663
3 SASI_Mm01_00213557 predicted 5999
4 SASI_Mm01_00213558 predicted 2516
5 SASI_Mm01_00213559 predicted 1764
6 SASI_Mm01_00213560 predicted 4834
7 SASI_Mm01_00213561 predicted 5717
8 SASI_Mm01_00213562 predicted 5693
9 SASI_Mm01_00213563 predicted 6803
10 SASI_Mm01_00213564 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014689
VALIDATED
DOCK10 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-2871s1c1
Sequence:CCGGCCAGGATTCCAACAAGGTAAACTCGAGTTTACCTTGTTGGAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014689.1-969s1c1
Sequence:CCGGCAATCCAAGTACCAATGAGAACTCGAGTTCTCATTGGTACTTGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014689.1-2057s1c1
Sequence:CCGGCTAAGCGTATAAGGACTGTTTCTCGAGAAACAGTCCTTATACGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-3873s1c1
Sequence:CCGGCCAGTGAATGTGTAGCTCAAACTCGAGTTTGAGCTACACATTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1441s1c1
Sequence:CCGGCCCAAACTCTTACAGATGTTACTCGAGTAACATCTGTAAGAGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1761s1c1
Sequence:CCGGCCTCTGTGGATCATTCTGTTACTCGAGTAACAGAATGATCCACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-837s21c1
Sequence:CCGGACCGTTACTGTTCGGTCATTCCTCGAGGAATGACCGAACAGTAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-5799s21c1
Sequence:CCGGTACGACATTCATCGGTCATATCTCGAGATATGACCGATGAATGTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-3503s21c1
Sequence:CCGGTAAGACCTTGTGCCAGTATAACTCGAGTTATACTGGCACAAGGTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-1480s21c1
Sequence:CCGGATGATCCGATAACGAATATTGCTCGAGCAATATTCGTTATCGGATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014689
VALIDATED
DOCK10 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-2871s1c1
Sequence:CCGGCCAGGATTCCAACAAGGTAAACTCGAGTTTACCTTGTTGGAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014689.1-969s1c1
Sequence:CCGGCAATCCAAGTACCAATGAGAACTCGAGTTCTCATTGGTACTTGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014689.1-2057s1c1
Sequence:CCGGCTAAGCGTATAAGGACTGTTTCTCGAGAAACAGTCCTTATACGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-3873s1c1
Sequence:CCGGCCAGTGAATGTGTAGCTCAAACTCGAGTTTGAGCTACACATTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1441s1c1
Sequence:CCGGCCCAAACTCTTACAGATGTTACTCGAGTAACATCTGTAAGAGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1761s1c1
Sequence:CCGGCCTCTGTGGATCATTCTGTTACTCGAGTAACAGAATGATCCACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-837s21c1
Sequence:CCGGACCGTTACTGTTCGGTCATTCCTCGAGGAATGACCGAACAGTAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-5799s21c1
Sequence:CCGGTACGACATTCATCGGTCATATCTCGAGATATGACCGATGAATGTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-3503s21c1
Sequence:CCGGTAAGACCTTGTGCCAGTATAACTCGAGTTATACTGGCACAAGGTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-1480s21c1
Sequence:CCGGATGATCCGATAACGAATATTGCTCGAGCAATATTCGTTATCGGATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014689
VALIDATED
DOCK10 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-2871s1c1
Sequence:CCGGCCAGGATTCCAACAAGGTAAACTCGAGTTTACCTTGTTGGAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014689.1-969s1c1
Sequence:CCGGCAATCCAAGTACCAATGAGAACTCGAGTTCTCATTGGTACTTGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014689.1-2057s1c1
Sequence:CCGGCTAAGCGTATAAGGACTGTTTCTCGAGAAACAGTCCTTATACGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-3873s1c1
Sequence:CCGGCCAGTGAATGTGTAGCTCAAACTCGAGTTTGAGCTACACATTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1441s1c1
Sequence:CCGGCCCAAACTCTTACAGATGTTACTCGAGTAACATCTGTAAGAGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014689.1-1761s1c1
Sequence:CCGGCCTCTGTGGATCATTCTGTTACTCGAGTAACAGAATGATCCACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-837s21c1
Sequence:CCGGACCGTTACTGTTCGGTCATTCCTCGAGGAATGACCGAACAGTAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-5799s21c1
Sequence:CCGGTACGACATTCATCGGTCATATCTCGAGATATGACCGATGAATGTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-3503s21c1
Sequence:CCGGTAAGACCTTGTGCCAGTATAACTCGAGTTATACTGGCACAAGGTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014689.2-1480s21c1
Sequence:CCGGATGATCCGATAACGAATATTGCTCGAGCAATATTCGTTATCGGATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175291
DOCK10 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1665s21c1
Sequence:CCGGGAGTGGTGCTGAACCTTATATCTCGAGATATAAGGTTCAGCACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-2097s21c1
Sequence:CCGGTTGCCGTCCATACCGAGTATACTCGAGTATACTCGGTATGGACGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175291.3-7121s21c1
Sequence:CCGGGTAACGTTTCAGATGTTATATCTCGAGATATAACATCTGAAACGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-4246s21c1
Sequence:CCGGTACCTAGGGAAACGCAATATACTCGAGTATATTGCGTTTCCCTAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1346s21c1
Sequence:CCGGATGACCCTGTAACCAATATTGCTCGAGCAATATTGGTTACAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175291
DOCK10 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1665s21c1
Sequence:CCGGGAGTGGTGCTGAACCTTATATCTCGAGATATAAGGTTCAGCACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-2097s21c1
Sequence:CCGGTTGCCGTCCATACCGAGTATACTCGAGTATACTCGGTATGGACGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175291.3-7121s21c1
Sequence:CCGGGTAACGTTTCAGATGTTATATCTCGAGATATAACATCTGAAACGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-4246s21c1
Sequence:CCGGTACCTAGGGAAACGCAATATACTCGAGTATATTGCGTTTCCCTAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1346s21c1
Sequence:CCGGATGACCCTGTAACCAATATTGCTCGAGCAATATTGGTTACAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175291
DOCK10 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1665s21c1
Sequence:CCGGGAGTGGTGCTGAACCTTATATCTCGAGATATAAGGTTCAGCACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-2097s21c1
Sequence:CCGGTTGCCGTCCATACCGAGTATACTCGAGTATACTCGGTATGGACGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175291.3-7121s21c1
Sequence:CCGGGTAACGTTTCAGATGTTATATCTCGAGATATAACATCTGAAACGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-4246s21c1
Sequence:CCGGTACCTAGGGAAACGCAATATACTCGAGTATATTGCGTTTCCCTAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175291.3-1346s21c1
Sequence:CCGGATGACCCTGTAACCAATATTGCTCGAGCAATATTGGTTACAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)