EMAIL THIS PAGE TO A FRIEND

DOCK11

dedicator of cytokinesis 11

79 Gene Product Result for
Synonyms: ACG ZIZ2 bB128O4.1
UniProtKB ID: Q5JSL3, A6NMF0, Q66M66, Q6ZUJ5, Q86VU8, Q96MN3
Gene ID:
Mouse(75974) dedicator of cytokinesis 11
Rat(313438) dedicator of cytokinesis 11
chicken(422229) dedicator of cytokinesis 11
dog(492089) dedicator of cytokinesis 11
cow(537297) dedicator of cytokinesis 11
Horse(100055441) dedicator of cytokinesis 11
domestic cat(101091093) dedicator of cytokinesis 11
domestic guinea pig(100731372) dedicator of cytokinesis 11
naked mole-rat(101723368) dedicator of cytokinesis 11
sheep(101108113) dedicator of cytokinesis 11
Domestic Rabbit(100354317) dedicator of cytokinesis 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059371 MISSION® esiRNA esiRNA human DOCK11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144658 Rosetta Predictions human pricing
XM_001061988 Rosetta Predictions rat pricing
XM_233283 Rosetta Predictions rat pricing
NM_001009947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109889 predicted 1112
2 SASI_Hs01_00109890 predicted 779
3 SASI_Hs02_00364540 predicted 6218
4 SASI_Hs01_00109891 predicted 607
5 SASI_Hs01_00109892 predicted 644
6 SASI_Hs01_00109893 predicted 3591
7 SASI_Hs01_00109894 predicted 1201
8 SASI_Hs01_00109895 predicted 288
9 SASI_Hs01_00109896 predicted 4658
10 SASI_Hs02_00364541 predicted 5214
11 SASI_Hs01_00109888 predicted 5268
12 SASI_Hs01_00109897 predicted 5925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302005 predicted 4127
2 SASI_Rn02_00302006 predicted 1375
3 SASI_Rn02_00302007 predicted 5399
4 SASI_Rn02_00302008 predicted 4697
5 SASI_Rn02_00302009 predicted 5243
6 SASI_Rn02_00302010 predicted 5327
7 SASI_Rn02_00302011 predicted 6138
8 SASI_Rn02_00302012 predicted 4310
9 SASI_Rn02_00302013 predicted 5615
10 SASI_Rn02_00302014 predicted 6157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387602 predicted 3943
2 SASI_Rn02_00387603 predicted 1198
3 SASI_Rn02_00387604 predicted 5220
4 SASI_Rn02_00387605 predicted 4526
5 SASI_Rn02_00387606 predicted 5058
6 SASI_Rn02_00387607 predicted 5144
7 SASI_Rn02_00387608 predicted 5958
8 SASI_Rn02_00387609 predicted 4130
9 SASI_Rn02_00387610 predicted 5435
10 SASI_Rn02_00387611 predicted 5971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058810 predicted 3951
2 SASI_Mm01_00058811 predicted 743
3 SASI_Mm01_00058812 predicted 3498
4 SASI_Mm02_00286878 predicted 4781
5 SASI_Mm01_00058813 predicted 2457
6 SASI_Mm01_00058814 predicted 1197
7 SASI_Mm01_00058817 predicted 5225
8 SASI_Mm02_00286879 predicted 319
9 SASI_Mm01_00058818 predicted 4716
10 SASI_Mm01_00058819 predicted 5958
11 SASI_Mm01_00058815 predicted 2101
12 SASI_Mm01_00058816 predicted 3073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144658
VALIDATED
DOCK11 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 11
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4341s21c1
Sequence:CCGGTGATGGCCATAACCCATTAATCTCGAGATTAATGGGTTATGGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6060s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6414s21c1
Sequence:CCGGCCAACAGGGTGCTTACATATTCTCGAGAATATGTAAGCACCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4285s21c1
Sequence:CCGGGTACTAGACACCATATCATTTCTCGAGAAATGATATGGTGTCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-2447s21c1
Sequence:CCGGGGCAATGTAACGTGGATATTACTCGAGTAATATCCACGTTACATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-1113s21c1
Sequence:CCGGAGGAATTGAACCTGATATAAACTCGAGTTTATATCAGGTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144658.2-6302s1c1
Sequence:CCGGCGTGACAATGAGACTGACCTTCTCGAGAAGGTCAGTCTCATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144658.2-1440s1c1
Sequence:CCGGGCTACATACAACAGGGAATTTCTCGAGAAATTCCCTGTTGTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2509s1c1
Sequence:CCGGCCACTTAGAATCTACCATTTACTCGAGTAAATGGTAGATTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2411s1c1
Sequence:CCGGCCAGGCTACTTGAATCTGAATCTCGAGATTCAGATTCAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-4979s1c1
Sequence:CCGGGCGATGTGTTATGTCCATGTACTCGAGTACATGGACATAACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-3678s1c1
Sequence:CCGGGCTTTACTTCACCTGCCAATACTCGAGTATTGGCAGGTGAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-964s1c1
Sequence:CCGGCGAGAACATCATGGCAAGTTTCTCGAGAAACTTGCCATGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144658
VALIDATED
DOCK11 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 11
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4341s21c1
Sequence:CCGGTGATGGCCATAACCCATTAATCTCGAGATTAATGGGTTATGGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6060s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6414s21c1
Sequence:CCGGCCAACAGGGTGCTTACATATTCTCGAGAATATGTAAGCACCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4285s21c1
Sequence:CCGGGTACTAGACACCATATCATTTCTCGAGAAATGATATGGTGTCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-2447s21c1
Sequence:CCGGGGCAATGTAACGTGGATATTACTCGAGTAATATCCACGTTACATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-1113s21c1
Sequence:CCGGAGGAATTGAACCTGATATAAACTCGAGTTTATATCAGGTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144658.2-6302s1c1
Sequence:CCGGCGTGACAATGAGACTGACCTTCTCGAGAAGGTCAGTCTCATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144658.2-1440s1c1
Sequence:CCGGGCTACATACAACAGGGAATTTCTCGAGAAATTCCCTGTTGTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2509s1c1
Sequence:CCGGCCACTTAGAATCTACCATTTACTCGAGTAAATGGTAGATTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2411s1c1
Sequence:CCGGCCAGGCTACTTGAATCTGAATCTCGAGATTCAGATTCAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-4979s1c1
Sequence:CCGGGCGATGTGTTATGTCCATGTACTCGAGTACATGGACATAACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-3678s1c1
Sequence:CCGGGCTTTACTTCACCTGCCAATACTCGAGTATTGGCAGGTGAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-964s1c1
Sequence:CCGGCGAGAACATCATGGCAAGTTTCTCGAGAAACTTGCCATGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144658
VALIDATED
DOCK11 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 11
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4341s21c1
Sequence:CCGGTGATGGCCATAACCCATTAATCTCGAGATTAATGGGTTATGGCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6060s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-6414s21c1
Sequence:CCGGCCAACAGGGTGCTTACATATTCTCGAGAATATGTAAGCACCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144658.3-4285s21c1
Sequence:CCGGGTACTAGACACCATATCATTTCTCGAGAAATGATATGGTGTCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-2447s21c1
Sequence:CCGGGGCAATGTAACGTGGATATTACTCGAGTAATATCCACGTTACATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144658.3-1113s21c1
Sequence:CCGGAGGAATTGAACCTGATATAAACTCGAGTTTATATCAGGTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144658.2-6302s1c1
Sequence:CCGGCGTGACAATGAGACTGACCTTCTCGAGAAGGTCAGTCTCATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144658.2-1440s1c1
Sequence:CCGGGCTACATACAACAGGGAATTTCTCGAGAAATTCCCTGTTGTATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2509s1c1
Sequence:CCGGCCACTTAGAATCTACCATTTACTCGAGTAAATGGTAGATTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-2411s1c1
Sequence:CCGGCCAGGCTACTTGAATCTGAATCTCGAGATTCAGATTCAAGTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144658.2-4979s1c1
Sequence:CCGGGCGATGTGTTATGTCCATGTACTCGAGTACATGGACATAACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-3678s1c1
Sequence:CCGGGCTTTACTTCACCTGCCAATACTCGAGTATTGGCAGGTGAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144658.2-964s1c1
Sequence:CCGGCGAGAACATCATGGCAAGTTTCTCGAGAAACTTGCCATGATGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009947
DOCK11 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-688s1c1
Sequence:CCGGCAACTTCCTGATGGTTCATATCTCGAGATATGAACCATCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-2944s1c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-5604s21c1
Sequence:CCGGCACTTATGTGAAGCCGTATTTCTCGAGAAATACGGCTTCACATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-2944s21c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-6096s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-1288s21c1
Sequence:CCGGTTCATCAACCTCGCCTTATTTCTCGAGAAATAAGGCGAGGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009947.3-6376s21c1
Sequence:CCGGCTGTGCAACTGTTAGCATTTACTCGAGTAAATGCTAACAGTTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.1-925s1c1
Sequence:CCGGGACAGTTTAGTGCAAGAGAAACTCGAGTTTCTCTTGCACTAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009947
DOCK11 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-688s1c1
Sequence:CCGGCAACTTCCTGATGGTTCATATCTCGAGATATGAACCATCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-2944s1c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-5604s21c1
Sequence:CCGGCACTTATGTGAAGCCGTATTTCTCGAGAAATACGGCTTCACATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-2944s21c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-6096s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-1288s21c1
Sequence:CCGGTTCATCAACCTCGCCTTATTTCTCGAGAAATAAGGCGAGGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009947.3-6376s21c1
Sequence:CCGGCTGTGCAACTGTTAGCATTTACTCGAGTAAATGCTAACAGTTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.1-925s1c1
Sequence:CCGGGACAGTTTAGTGCAAGAGAAACTCGAGTTTCTCTTGCACTAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009947
DOCK11 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-688s1c1
Sequence:CCGGCAACTTCCTGATGGTTCATATCTCGAGATATGAACCATCAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.3-2944s1c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-5604s21c1
Sequence:CCGGCACTTATGTGAAGCCGTATTTCTCGAGAAATACGGCTTCACATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-2944s21c1
Sequence:CCGGGCAGATTTCCTAGCCATAAATCTCGAGATTTATGGCTAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-6096s21c1
Sequence:CCGGACTAAATGAGCGGCTAATTAACTCGAGTTAATTAGCCGCTCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009947.3-1288s21c1
Sequence:CCGGTTCATCAACCTCGCCTTATTTCTCGAGAAATAAGGCGAGGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009947.3-6376s21c1
Sequence:CCGGCTGTGCAACTGTTAGCATTTACTCGAGTAAATGCTAACAGTTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009947.1-925s1c1
Sequence:CCGGGACAGTTTAGTGCAAGAGAAACTCGAGTTTCTCTTGCACTAAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks