EMAIL THIS PAGE TO A FRIEND

DOCK1

dedicator of cytokinesis 1

63 Gene Product Result for
Synonyms: DOCK180 ced5
UniProtKB ID: Q14185, A9Z1Z5
Gene ID:
Human(1793) Summary: This gene product binds to the SH3 domain of CRK protein. It may regulate cell surface extension and may have a role in the cell surface extension of an engulfing cell around a dying cell during apoptosis. [provided by RefSeq, Jul 2008]
Mouse(330662) dedicator of cytokinesis 1
Rat(309081) dedicator of cyto-kinesis 1
Zebrafish(572187) dedicator of cytokinesis 1
cow(537203) dedicator of cytokinesis 1
Horse(100055697) dedicator of cytokinesis 1
domestic cat(101084320) dedicator of cytokinesis 1
dog(486934) dedicator of cytokinesis 1
chicken(423960) dedicator of cytokinesis 1
domestic guinea pig(100734315) dedicator of cytokinesis 1
naked mole-rat(101718612) dedicator of cytokinesis 1
sheep(101117205) dedicator of cytokinesis 1
Domestic Rabbit(100342405) dedicator of cytokinesis 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001380 Rosetta Predictions human pricing
XM_219424 Rosetta Predictions rat pricing
NM_001033420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246616 predicted 592
2 SASI_Hs01_00246617 predicted 4405
3 SASI_Hs01_00246618 predicted 216
4 SASI_Hs01_00246619 predicted 2465
5 SASI_Hs01_00246620 predicted 5745
6 SASI_Hs02_00331732 predicted 1715
7 SASI_Hs01_00246621 predicted 3304
8 SASI_Hs02_00331733 predicted 4437
9 SASI_Hs01_00246623 predicted 2567
10 SASI_Hs01_00246624 predicted 3585
11 SASI_Hs01_00246622 predicted 2286
12 SASI_Hs01_00246625 predicted 2905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378474 predicted 4024
2 SASI_Rn02_00378475 predicted 3947
3 SASI_Rn02_00378476 predicted 4511
4 SASI_Rn02_00378477 predicted 2575
5 SASI_Rn02_00378478 predicted 3324
6 SASI_Rn02_00378479 predicted 4473
7 SASI_Rn02_00378480 predicted 2896
8 SASI_Rn02_00378481 predicted 4459
9 SASI_Rn02_00378482 predicted 3500
10 SASI_Rn02_00378483 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039685 predicted 1239
2 SASI_Mm01_00039686 predicted 3287
3 SASI_Mm01_00039687 predicted 4497
4 SASI_Mm01_00039688 predicted 4019
5 SASI_Mm01_00039689 predicted 4993
6 SASI_Mm01_00039690 predicted 3495
7 SASI_Mm01_00039691 predicted 2154
8 SASI_Mm02_00288721 predicted 3540
9 SASI_Mm01_00039693 predicted 4459
10 SASI_Mm01_00039694 predicted 2843
11 SASI_Mm01_00039692 predicted 4193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001380
DOCK1 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3217s21c1
Sequence:CCGGCCTTAACAAGTACGGAGATATCTCGAGATATCTCCGTACTTGTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3046s21c1
Sequence:CCGGAGTCTTCCTGCGAGCAATTAACTCGAGTTAATTGCTCGCAGGAAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-1707s21c1
Sequence:CCGGAGCACGATCTTATCGTCTATACTCGAGTATAGACGATAAGATCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-4437s21c1
Sequence:CCGGGGATCGAGAGAACCATATATACTCGAGTATATATGGTTCTCTCGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-3925s1c1
Sequence:CCGGCCGAGCAGTATGAGAACGAAACTCGAGTTTCGTTCTCATACTGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-161s1c1
Sequence:CCGGCCGAGGTTACACGTTACGAAACTCGAGTTTCGTAACGTGTAACCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-693s1c1
Sequence:CCGGGCCTTGTTTGTGAACCTCAAACTCGAGTTTGAGGTTCACAAACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-4371s1c1
Sequence:CCGGCCAGACAATGAATTTGCGAATCTCGAGATTCGCAAATTCATTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-5444s1c1
Sequence:CCGGCGTGGCAGATTACGGGAATTTCTCGAGAAATTCCCGTAATCTGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001380
DOCK1 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3217s21c1
Sequence:CCGGCCTTAACAAGTACGGAGATATCTCGAGATATCTCCGTACTTGTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3046s21c1
Sequence:CCGGAGTCTTCCTGCGAGCAATTAACTCGAGTTAATTGCTCGCAGGAAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-1707s21c1
Sequence:CCGGAGCACGATCTTATCGTCTATACTCGAGTATAGACGATAAGATCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-4437s21c1
Sequence:CCGGGGATCGAGAGAACCATATATACTCGAGTATATATGGTTCTCTCGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-3925s1c1
Sequence:CCGGCCGAGCAGTATGAGAACGAAACTCGAGTTTCGTTCTCATACTGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-161s1c1
Sequence:CCGGCCGAGGTTACACGTTACGAAACTCGAGTTTCGTAACGTGTAACCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-693s1c1
Sequence:CCGGGCCTTGTTTGTGAACCTCAAACTCGAGTTTGAGGTTCACAAACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-4371s1c1
Sequence:CCGGCCAGACAATGAATTTGCGAATCTCGAGATTCGCAAATTCATTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-5444s1c1
Sequence:CCGGCGTGGCAGATTACGGGAATTTCTCGAGAAATTCCCGTAATCTGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001380
DOCK1 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3217s21c1
Sequence:CCGGCCTTAACAAGTACGGAGATATCTCGAGATATCTCCGTACTTGTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-3046s21c1
Sequence:CCGGAGTCTTCCTGCGAGCAATTAACTCGAGTTAATTGCTCGCAGGAAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-1707s21c1
Sequence:CCGGAGCACGATCTTATCGTCTATACTCGAGTATAGACGATAAGATCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001380.3-4437s21c1
Sequence:CCGGGGATCGAGAGAACCATATATACTCGAGTATATATGGTTCTCTCGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-3925s1c1
Sequence:CCGGCCGAGCAGTATGAGAACGAAACTCGAGTTTCGTTCTCATACTGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-161s1c1
Sequence:CCGGCCGAGGTTACACGTTACGAAACTCGAGTTTCGTAACGTGTAACCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-693s1c1
Sequence:CCGGGCCTTGTTTGTGAACCTCAAACTCGAGTTTGAGGTTCACAAACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-4371s1c1
Sequence:CCGGCCAGACAATGAATTTGCGAATCTCGAGATTCGCAAATTCATTGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001380.1-5444s1c1
Sequence:CCGGCGTGGCAGATTACGGGAATTTCTCGAGAAATTCCCGTAATCTGCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033420
VALIDATED
DOCK1 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1539s21c1
Sequence:CCGGCCGAGTACAAATCGGTGATTTCTCGAGAAATCACCGATTTGTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-6332s21c1
Sequence:CCGGACGGCGTAGAGACACCATTATCTCGAGATAATGGTGTCTCTACGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4499s21c1
Sequence:CCGGATCTACACTACGGCCTATAAACTCGAGTTTATAGGCCGTAGTGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4343s21c1
Sequence:CCGGCTAGACTTACCTCCGAGATTTCTCGAGAAATCTCGGAGGTAAGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1491s21c1
Sequence:CCGGAGCGATTGGAGCACGTGATTTCTCGAGAAATCACGTGCTCCAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033420
VALIDATED
DOCK1 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1539s21c1
Sequence:CCGGCCGAGTACAAATCGGTGATTTCTCGAGAAATCACCGATTTGTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-6332s21c1
Sequence:CCGGACGGCGTAGAGACACCATTATCTCGAGATAATGGTGTCTCTACGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4499s21c1
Sequence:CCGGATCTACACTACGGCCTATAAACTCGAGTTTATAGGCCGTAGTGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4343s21c1
Sequence:CCGGCTAGACTTACCTCCGAGATTTCTCGAGAAATCTCGGAGGTAAGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1491s21c1
Sequence:CCGGAGCGATTGGAGCACGTGATTTCTCGAGAAATCACGTGCTCCAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033420
VALIDATED
DOCK1 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1539s21c1
Sequence:CCGGCCGAGTACAAATCGGTGATTTCTCGAGAAATCACCGATTTGTACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-6332s21c1
Sequence:CCGGACGGCGTAGAGACACCATTATCTCGAGATAATGGTGTCTCTACGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4499s21c1
Sequence:CCGGATCTACACTACGGCCTATAAACTCGAGTTTATAGGCCGTAGTGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-4343s21c1
Sequence:CCGGCTAGACTTACCTCCGAGATTTCTCGAGAAATCTCGGAGGTAAGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033420.2-1491s21c1
Sequence:CCGGAGCGATTGGAGCACGTGATTTCTCGAGAAATCACGTGCTCCAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)