EMAIL THIS PAGE TO A FRIEND

DOCK2

dedicator of cytokinesis 2

UniProtKB ID: Q92608, Q2M3I0, Q96AK7
Gene ID:
Human(1794) Summary: The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells, predominantly in the peripheral blood leukocytes, and is involved in remodeling of the actin cytoskeleton required for lymphocyte migration, through the activation of RAC. Mice lacking this gene show a severe impairment in the migration and homing of lymphocytes. These mutant mice also exhibited long-term survival of allografts, suggesting that this gene may be a target for controlling transplant rejection. [provided by RefSeq, Oct 2011]
Mouse(94176) dedicator of cyto-kinesis 2
Rat(360509) dedicator of cytokinesis 2
Zebrafish(571408) dedicator of cyto-kinesis 2
cow(510083) dedicator of cytokinesis 2
cow(281745) dedicator of cytokinesis 2
Horse(100070446) dedicator of cytokinesis 2
domestic cat(101097544) dedicator of cytokinesis 2
dog(489128) dedicator of cytokinesis 2
Zebrafish(100330200) dedicator of cytokinesis 2
chicken(427612) dedicator of cytokinesis 2
sheep(101104011) dedicator of cytokinesis 2
naked mole-rat(101707633) dedicator of cytokinesis 2
domestic guinea pig(100714041) dedicator of cytokinesis 2
Gene Class: Cytoskeleton
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004946 Rosetta Predictions human pricing
XM_001063344 Rosetta Predictions rat pricing
XM_001068649 Rosetta Predictions rat pricing
NM_033374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204031 predicted 2078
2 SASI_Hs01_00204034 predicted 4339
3 SASI_Hs01_00204035 predicted 2221
4 SASI_Hs01_00204036 predicted 1451
5 SASI_Hs01_00204037 predicted 4423
6 SASI_Hs01_00204038 predicted 3250
7 SASI_Hs01_00204039 predicted 2829
8 SASI_Hs02_00338617 predicted 5139
9 SASI_Hs01_00204040 predicted 1868
10 SASI_Hs02_00338618 predicted 2337
11 SASI_Hs01_00204032 predicted 2853
12 SASI_Hs01_00204033 predicted 2589
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306771 predicted 448
2 SASI_Rn02_00306772 predicted 603
3 SASI_Rn02_00306773 predicted 658
4 SASI_Rn02_00306774 predicted 620
5 SASI_Rn02_00306775 predicted 753
6 SASI_Rn02_00306776 predicted 252
7 SASI_Rn02_00306777 predicted 657
8 SASI_Rn02_00306778 predicted 861
9 SASI_Rn02_00306779 predicted 392
10 SASI_Rn02_00306780 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325314 predicted 1467
2 SASI_Rn02_00325315 predicted 3900
3 SASI_Rn02_00325316 predicted 2083
4 SASI_Rn02_00325317 predicted 2293
5 SASI_Rn02_00325318 predicted 4459
6 SASI_Rn02_00325319 predicted 4270
7 SASI_Rn02_00325320 predicted 2397
8 SASI_Rn02_00325321 predicted 1455
9 SASI_Rn02_00325322 predicted 3982
10 SASI_Rn02_00325323 predicted 3198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337346 predicted 3832
2 SASI_Mm02_00337347 predicted 2247
3 SASI_Mm01_00142518 predicted 2549
4 SASI_Mm02_00337348 predicted 519
5 SASI_Mm01_00142519 predicted 2509
6 SASI_Mm01_00142520 predicted 728
7 SASI_Mm01_00142521 predicted 893
8 SASI_Mm01_00142522 predicted 802
9 SASI_Mm01_00142523 predicted 967
10 SASI_Mm01_00142524 predicted 1509
11 SASI_Mm01_00142525 predicted 2709
12 SASI_Mm01_00142526 predicted 676
13 SASI_Mm01_00142527 predicted 4745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033374
DOCK2 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-4494s1c1
Sequence:CCGGCGAGACTATGTCCACAGTCAACTCGAGTTGACTGTGGACATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-3268s1c1
Sequence:CCGGCCTATATTAGAGATGACACTTCTCGAGAAGTGTCATCTCTAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1020s1c1
Sequence:CCGGCGACGAAGAGAAGCAACATTTCTCGAGAAATGTTGCTTCTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-2001s1c1
Sequence:CCGGCGAGTATGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1019s1c1
Sequence:CCGGGCGACGAAGAGAAGCAACATTCTCGAGAATGTTGCTTCTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033374
DOCK2 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-4494s1c1
Sequence:CCGGCGAGACTATGTCCACAGTCAACTCGAGTTGACTGTGGACATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-3268s1c1
Sequence:CCGGCCTATATTAGAGATGACACTTCTCGAGAAGTGTCATCTCTAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1020s1c1
Sequence:CCGGCGACGAAGAGAAGCAACATTTCTCGAGAAATGTTGCTTCTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-2001s1c1
Sequence:CCGGCGAGTATGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1019s1c1
Sequence:CCGGGCGACGAAGAGAAGCAACATTCTCGAGAATGTTGCTTCTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033374
DOCK2 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-4494s1c1
Sequence:CCGGCGAGACTATGTCCACAGTCAACTCGAGTTGACTGTGGACATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-3268s1c1
Sequence:CCGGCCTATATTAGAGATGACACTTCTCGAGAAGTGTCATCTCTAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1020s1c1
Sequence:CCGGCGACGAAGAGAAGCAACATTTCTCGAGAAATGTTGCTTCTCTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-2001s1c1
Sequence:CCGGCGAGTATGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033374.1-1019s1c1
Sequence:CCGGGCGACGAAGAGAAGCAACATTCTCGAGAATGTTGCTTCTCTTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004946
DOCK2 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004946.1-5834s1c1
Sequence:CCGGCCAGTTTCTTAGGTGTAAGAACTCGAGTTCTTACACCTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-1467s1c1
Sequence:CCGGCGCTCCGTTGTGTACTATCAACTCGAGTTGATAGTACACAACGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-5039s1c1
Sequence:CCGGCCTGGAATTAGCATCACCCAACTCGAGTTGGGTGATGCTAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-2885s1c1
Sequence:CCGGCCAGCACTACTCCTTCTACATCTCGAGATGTAGAAGGAGTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-777s1c1
Sequence:CCGGCCCAACAAGCAAACGGTCATACTCGAGTATGACCGTTTGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-236s1c1
Sequence:CCGGCAAGGAAGTGACAGTTGAGAACTCGAGTTCTCAACTGTCACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-4954s1c1
Sequence:CCGGCATACAGACAGATGTCCATCACTCGAGTGATGGACATCTGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004946
DOCK2 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004946.1-5834s1c1
Sequence:CCGGCCAGTTTCTTAGGTGTAAGAACTCGAGTTCTTACACCTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-1467s1c1
Sequence:CCGGCGCTCCGTTGTGTACTATCAACTCGAGTTGATAGTACACAACGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-5039s1c1
Sequence:CCGGCCTGGAATTAGCATCACCCAACTCGAGTTGGGTGATGCTAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-2885s1c1
Sequence:CCGGCCAGCACTACTCCTTCTACATCTCGAGATGTAGAAGGAGTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-777s1c1
Sequence:CCGGCCCAACAAGCAAACGGTCATACTCGAGTATGACCGTTTGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-236s1c1
Sequence:CCGGCAAGGAAGTGACAGTTGAGAACTCGAGTTCTCAACTGTCACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-4954s1c1
Sequence:CCGGCATACAGACAGATGTCCATCACTCGAGTGATGGACATCTGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004946
DOCK2 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004946.1-5834s1c1
Sequence:CCGGCCAGTTTCTTAGGTGTAAGAACTCGAGTTCTTACACCTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-1467s1c1
Sequence:CCGGCGCTCCGTTGTGTACTATCAACTCGAGTTGATAGTACACAACGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-5039s1c1
Sequence:CCGGCCTGGAATTAGCATCACCCAACTCGAGTTGGGTGATGCTAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-2885s1c1
Sequence:CCGGCCAGCACTACTCCTTCTACATCTCGAGATGTAGAAGGAGTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.1-777s1c1
Sequence:CCGGCCCAACAAGCAAACGGTCATACTCGAGTATGACCGTTTGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-236s1c1
Sequence:CCGGCAAGGAAGTGACAGTTGAGAACTCGAGTTCTCAACTGTCACTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004946.x-4954s1c1
Sequence:CCGGCATACAGACAGATGTCCATCACTCGAGTGATGGACATCTGTCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks