EMAIL THIS PAGE TO A FRIEND

DOCK3

dedicator of cytokinesis 3

189 Gene Product Result for
Synonyms: MOCA PBP
UniProtKB ID: Q8IZD9, O15017
Gene ID:
Human(1795) Summary: This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins]
Mouse(208869) dedicator of cyto-kinesis 3
Rat(315992) dedicator of cyto-kinesis 3
domestic guinea pig(100734379) dedicator of cytokinesis 3
naked mole-rat(101718931) dedicator of cytokinesis 3
sheep(101114650) dedicator of cytokinesis 3
Domestic Rabbit(100341267) dedicator of cytokinesis 3
Zebrafish(100536057) dedicator of cytokinesis 3
Horse(100061408) dedicator of cytokinesis 3
domestic cat(101090678) dedicator of cytokinesis 3
dog(476610) dedicator of cytokinesis 3
chicken(415919) dedicator of cytokinesis 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004947 Rosetta Predictions human pricing
NM_001108184 Rosetta Predictions rat pricing
NM_153413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168540 predicted 3099
2 SASI_Hs01_00168541 predicted 1986
3 SASI_Hs01_00168542 predicted 4299
4 SASI_Hs01_00168543 predicted 4688
5 SASI_Hs01_00168544 predicted 1397
6 SASI_Hs02_00338619 predicted 5785
7 SASI_Hs01_00168545 predicted 4834
8 SASI_Hs01_00168547 predicted 2633
9 SASI_Hs01_00168548 predicted 4035
10 SASI_Hs01_00168549 predicted 3503
11 SASI_Hs01_00168546 predicted 2084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236164 predicted 1753
2 SASI_Rn02_00236165 predicted 3615
3 SASI_Rn02_00236166 predicted 4361
4 SASI_Rn02_00236167 predicted 1001
5 SASI_Rn02_00236168 predicted 2408
6 SASI_Rn02_00236169 predicted 1766
7 SASI_Rn02_00236170 predicted 3084
8 SASI_Rn02_00236171 predicted 367
9 SASI_Rn02_00236172 predicted 4302
10 SASI_Rn02_00236173 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107158 predicted 3609
2 SASI_Mm02_00343198 predicted 5040
3 SASI_Mm02_00343199 predicted 4072
4 SASI_Mm01_00107159 predicted 5212
5 SASI_Mm02_00343200 predicted 1352
6 SASI_Mm01_00107164 predicted 1799
7 SASI_Mm01_00107165 predicted 6086
8 SASI_Mm02_00343201 predicted 1919
9 SASI_Mm02_00343202 predicted 4546
10 SASI_Mm02_00343203 predicted 4962
11 SASI_Mm01_00107160 predicted 1827
12 SASI_Mm01_00107161 predicted 767
13 SASI_Mm01_00107162 predicted 1813
14 SASI_Mm01_00107163 predicted 2002
15 SASI_Mm01_00107166 predicted 973
16 SASI_Mm01_00107167 predicted 1312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004947
DOCK3 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4851s1c1
Sequence:CCGGCCTCTGCATAAGAAGCTAATTCTCGAGAATTAGCTTCTTATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4035s1c1
Sequence:CCGGGCCAGCTACTATGACAACATTCTCGAGAATGTTGTCATAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-1547s1c1
Sequence:CCGGGTTCAGACATTGTTCCACAAACTCGAGTTTGTGGAACAATGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004947.3-7733s1c1
Sequence:CCGGCCCAGCTTGTTTAACAGAAATCTCGAGATTTCTGTTAAACAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-2135s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTATATCTCGAGATATACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004947.3-6580s21c1
Sequence:CCGGGGGATTGCAAGGACCATATAGCTCGAGCTATATGGTCCTTGCAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004947.3-1674s21c1
Sequence:CCGGGATGAGAATAGCACGTTTAATCTCGAGATTAAACGTGCTATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004947
DOCK3 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4851s1c1
Sequence:CCGGCCTCTGCATAAGAAGCTAATTCTCGAGAATTAGCTTCTTATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4035s1c1
Sequence:CCGGGCCAGCTACTATGACAACATTCTCGAGAATGTTGTCATAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-1547s1c1
Sequence:CCGGGTTCAGACATTGTTCCACAAACTCGAGTTTGTGGAACAATGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004947.3-7733s1c1
Sequence:CCGGCCCAGCTTGTTTAACAGAAATCTCGAGATTTCTGTTAAACAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-2135s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTATATCTCGAGATATACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004947.3-6580s21c1
Sequence:CCGGGGGATTGCAAGGACCATATAGCTCGAGCTATATGGTCCTTGCAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004947.3-1674s21c1
Sequence:CCGGGATGAGAATAGCACGTTTAATCTCGAGATTAAACGTGCTATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004947
DOCK3 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4851s1c1
Sequence:CCGGCCTCTGCATAAGAAGCTAATTCTCGAGAATTAGCTTCTTATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-4035s1c1
Sequence:CCGGGCCAGCTACTATGACAACATTCTCGAGAATGTTGTCATAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-1547s1c1
Sequence:CCGGGTTCAGACATTGTTCCACAAACTCGAGTTTGTGGAACAATGTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004947.3-7733s1c1
Sequence:CCGGCCCAGCTTGTTTAACAGAAATCTCGAGATTTCTGTTAAACAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004947.3-2135s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTATATCTCGAGATATACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004947.3-6580s21c1
Sequence:CCGGGGGATTGCAAGGACCATATAGCTCGAGCTATATGGTCCTTGCAATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004947.3-1674s21c1
Sequence:CCGGGATGAGAATAGCACGTTTAATCTCGAGATTAAACGTGCTATTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153413
DOCK3 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-5819s1c1
Sequence:CCGGCCAATCTGTCTATGGCTGAAACTCGAGTTTCAGCCATAGACAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-699s1c1
Sequence:CCGGCCATGTGATGAATGAACTTATCTCGAGATAAGTTCATTCATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-1143s1c1
Sequence:CCGGCCCAGAGAAGATAGAACGAATCTCGAGATTCGTTCTATCTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2395s1c1
Sequence:CCGGCGACCTGTAATGGACACATATCTCGAGATATGTGTCCATTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2460s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTACATCTCGAGATGTACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153413
DOCK3 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-5819s1c1
Sequence:CCGGCCAATCTGTCTATGGCTGAAACTCGAGTTTCAGCCATAGACAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-699s1c1
Sequence:CCGGCCATGTGATGAATGAACTTATCTCGAGATAAGTTCATTCATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-1143s1c1
Sequence:CCGGCCCAGAGAAGATAGAACGAATCTCGAGATTCGTTCTATCTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2395s1c1
Sequence:CCGGCGACCTGTAATGGACACATATCTCGAGATATGTGTCCATTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2460s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTACATCTCGAGATGTACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153413
DOCK3 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-5819s1c1
Sequence:CCGGCCAATCTGTCTATGGCTGAAACTCGAGTTTCAGCCATAGACAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-699s1c1
Sequence:CCGGCCATGTGATGAATGAACTTATCTCGAGATAAGTTCATTCATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-1143s1c1
Sequence:CCGGCCCAGAGAAGATAGAACGAATCTCGAGATTCGTTCTATCTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2395s1c1
Sequence:CCGGCGACCTGTAATGGACACATATCTCGAGATATGTGTCCATTACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153413.1-2460s1c1
Sequence:CCGGCCGCTGTTTGAAGTGGTACATCTCGAGATGTACCACTTCAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks