EMAIL THIS PAGE TO A FRIEND

DOCK4

dedicator of cytokinesis 4

UniProtKB ID: Q8N1I0, O14584, O94824, Q8NB45
Gene ID:
Human(9732) Summary: This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(238130) dedicator of cytokinesis 4
chicken(417779) dedicator of cytokinesis 4
domestic cat(101082809) dedicator of cytokinesis 4
cow(534227) dedicator of cytokinesis 4
Horse(100055674) dedicator of cytokinesis 4
dog(482407) dedicator of cytokinesis 4
sheep(101113058) dedicator of cytokinesis 4
Domestic Rabbit(100355539) dedicator of cytokinesis 4
naked mole-rat(101721066) dedicator of cytokinesis 4
domestic guinea pig(100716726) dedicator of cytokinesis 4
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014705 Rosetta Predictions human pricing
NM_172803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030459 predicted 1801
2 SASI_Hs02_00346119 predicted 1212
3 SASI_Hs01_00030460 predicted 1067
4 SASI_Hs01_00030461 predicted 3917
5 SASI_Hs01_00030462 predicted 4078
6 SASI_Hs01_00030463 predicted 3169
7 SASI_Hs01_00030464 predicted 4764
8 SASI_Hs01_00030465 predicted 4821
9 SASI_Hs01_00030466 predicted 2821
10 SASI_Hs01_00030467 predicted 313
11 SASI_Hs01_00030468 predicted 4111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052057 predicted 4888
2 SASI_Mm01_00052058 predicted 2715
3 SASI_Mm01_00052059 predicted 5776
4 SASI_Mm01_00052060 predicted 4142
5 SASI_Mm01_00052061 predicted 4174
6 SASI_Mm01_00052062 predicted 3697
7 SASI_Mm01_00052063 predicted 517
8 SASI_Mm01_00052064 predicted 452
9 SASI_Mm01_00052065 predicted 6242
10 SASI_Mm02_00344720 predicted 2507
11 SASI_Mm01_00052066 predicted 6304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014705
VALIDATED
DOCK4 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014705.3-5588s21c1
Sequence:CCGGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-3234s21c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-4944s21c1
Sequence:CCGGGCCGTGCATGAGAAGTTTGTACTCGAGTACAAACTTCTCATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-2826s21c1
Sequence:CCGGCGTATCCTTAGCAACGTATTTCTCGAGAAATACGTTGCTAAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-6574s21c1
Sequence:CCGGCTAACACAGTGGTCCTTATTTCTCGAGAAATAAGGACCACTGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.2-2965s1c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-5319s1c1
Sequence:CCGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014705.x-6s1c1
Sequence:CCGGATACCTACGGAGCACGAGAACTCGAGTTCTCGTGCTCCGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-111s1c1
Sequence:CCGGAAGTGTGATGGCTGGTACAGCTCGAGCTGTACCAGCCATCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014705
VALIDATED
DOCK4 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014705.3-5588s21c1
Sequence:CCGGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-3234s21c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-4944s21c1
Sequence:CCGGGCCGTGCATGAGAAGTTTGTACTCGAGTACAAACTTCTCATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-2826s21c1
Sequence:CCGGCGTATCCTTAGCAACGTATTTCTCGAGAAATACGTTGCTAAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-6574s21c1
Sequence:CCGGCTAACACAGTGGTCCTTATTTCTCGAGAAATAAGGACCACTGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.2-2965s1c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-5319s1c1
Sequence:CCGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014705.x-6s1c1
Sequence:CCGGATACCTACGGAGCACGAGAACTCGAGTTCTCGTGCTCCGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-111s1c1
Sequence:CCGGAAGTGTGATGGCTGGTACAGCTCGAGCTGTACCAGCCATCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014705
VALIDATED
DOCK4 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014705.3-5588s21c1
Sequence:CCGGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-3234s21c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-4944s21c1
Sequence:CCGGGCCGTGCATGAGAAGTTTGTACTCGAGTACAAACTTCTCATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-2826s21c1
Sequence:CCGGCGTATCCTTAGCAACGTATTTCTCGAGAAATACGTTGCTAAGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014705.3-6574s21c1
Sequence:CCGGCTAACACAGTGGTCCTTATTTCTCGAGAAATAAGGACCACTGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.2-2965s1c1
Sequence:CCGGGCACTTCGTAAGAACTTCTTACTCGAGTAAGAAGTTCTTACGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-5319s1c1
Sequence:CCGGAAGGAAGCCAAGAACATGTCCTCGAGGACATGTTCTTGGCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014705.x-6s1c1
Sequence:CCGGATACCTACGGAGCACGAGAACTCGAGTTCTCGTGCTCCGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014705.x-111s1c1
Sequence:CCGGAAGTGTGATGGCTGGTACAGCTCGAGCTGTACCAGCCATCACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172803
VALIDATED
DOCK4 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6417s1c1
Sequence:CCGGCGCCAGATGTTACATGAAATACTCGAGTATTTCATGTAACATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-849s1c1
Sequence:CCGGCGACTGATGGAACATCGACATCTCGAGATGTCGATGTTCCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3932s1c1
Sequence:CCGGCCGCTACATCCACAAACTCTACTCGAGTAGAGTTTGTGGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6221s1c1
Sequence:CCGGCCGTAAGGTGTCTCAGCTATACTCGAGTATAGCTGAGACACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3990s1c1
Sequence:CCGGGCCTACACTCTCCTGTTGTATCTCGAGATACAACAGGAGAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172803
VALIDATED
DOCK4 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6417s1c1
Sequence:CCGGCGCCAGATGTTACATGAAATACTCGAGTATTTCATGTAACATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-849s1c1
Sequence:CCGGCGACTGATGGAACATCGACATCTCGAGATGTCGATGTTCCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3932s1c1
Sequence:CCGGCCGCTACATCCACAAACTCTACTCGAGTAGAGTTTGTGGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6221s1c1
Sequence:CCGGCCGTAAGGTGTCTCAGCTATACTCGAGTATAGCTGAGACACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3990s1c1
Sequence:CCGGGCCTACACTCTCCTGTTGTATCTCGAGATACAACAGGAGAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172803
VALIDATED
DOCK4 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6417s1c1
Sequence:CCGGCGCCAGATGTTACATGAAATACTCGAGTATTTCATGTAACATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-849s1c1
Sequence:CCGGCGACTGATGGAACATCGACATCTCGAGATGTCGATGTTCCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3932s1c1
Sequence:CCGGCCGCTACATCCACAAACTCTACTCGAGTAGAGTTTGTGGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172803.2-6221s1c1
Sequence:CCGGCCGTAAGGTGTCTCAGCTATACTCGAGTATAGCTGAGACACCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172803.2-3990s1c1
Sequence:CCGGGCCTACACTCTCCTGTTGTATCTCGAGATACAACAGGAGAGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks