EMAIL THIS PAGE TO A FRIEND

DOCK5

dedicator of cytokinesis 5

180 Gene Product Result for
UniProtKB ID: Q9H7D0, B2RNY0, Q5XKD5, Q6AI11, Q6PJS6, Q6ZTS6
Gene ID:
Mouse(68813) dedicator of cytokinesis 5
Rat(305987) dedicator of cytokinesis 5
Zebrafish(571688) dedicator of cytokinesis 5
dog(100684965) dedicator of cytokinesis 5
domestic cat(101082055) dedicator of cytokinesis 5
Horse(100059224) dedicator of cytokinesis 5
cow(505572) dedicator of cytokinesis 5
chicken(419527) dedicator of cytokinesis 5
domestic guinea pig(100732726) dedicator of cytokinesis 5
naked mole-rat(101705022) dedicator of cytokinesis 5
sheep(101119284) dedicator of cytokinesis 5
Domestic Rabbit(100343877) dedicator of cytokinesis 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056837 Anti-DOCK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024940 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024940 Rosetta Predictions human pricing
NM_001107274 Rosetta Predictions rat pricing
NM_177780 Rosetta Predictions mouse pricing
XM_001003628 Rosetta Predictions mouse pricing
XM_001003634 Rosetta Predictions mouse pricing
XM_001003638 Rosetta Predictions mouse pricing
XM_001003643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125445 predicted 3223
2 SASI_Hs01_00125448 predicted 3988
3 SASI_Hs02_00357575 predicted 2478
4 SASI_Hs01_00125449 predicted 646
5 SASI_Hs02_00357576 predicted 4027
6 SASI_Hs02_00357577 predicted 4610
7 SASI_Hs01_00125450 predicted 1974
8 SASI_Hs02_00357578 predicted 2627
9 SASI_Hs01_00125452 predicted 2585
10 SASI_Hs01_00125453 predicted 4857
11 SASI_Hs01_00125444 predicted 5216
12 SASI_Hs01_00125446 predicted 4118
13 SASI_Hs01_00125447 predicted 5381
14 SASI_Hs01_00125451 predicted 3271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227225 predicted 2459
2 SASI_Rn02_00227226 predicted 1750
3 SASI_Rn02_00227227 predicted 1119
4 SASI_Rn02_00227228 predicted 1588
5 SASI_Rn02_00227229 predicted 785
6 SASI_Rn02_00227230 predicted 681
7 SASI_Rn02_00227231 predicted 1722
8 SASI_Rn02_00227232 predicted 2075
9 SASI_Rn02_00227233 predicted 1138
10 SASI_Rn02_00227234 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348186 predicted 2380
2 SASI_Mm02_00348187 predicted 1975
3 SASI_Mm02_00348188 predicted 4588
4 SASI_Mm02_00348189 predicted 3857
5 SASI_Mm02_00348190 predicted 778
6 SASI_Mm02_00348191 predicted 4133
7 SASI_Mm02_00348192 predicted 2298
8 SASI_Mm02_00348193 predicted 1945
9 SASI_Mm02_00348194 predicted 3237
10 SASI_Mm02_00348195 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256284 predicted 1976
2 SASI_Mm01_00256285 predicted 535
3 SASI_Mm01_00256286 predicted 1022
4 SASI_Mm01_00256287 predicted 1947
5 SASI_Mm01_00256288 predicted 1843
6 SASI_Mm01_00256289 predicted 2012
7 SASI_Mm01_00256290 predicted 2099
8 SASI_Mm01_00256291 predicted 1822
9 SASI_Mm01_00256292 predicted 1894
10 SASI_Mm01_00256293 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264558 predicted 2383
2 SASI_Mm01_00264559 predicted 1982
3 SASI_Mm01_00264560 predicted 4592
4 SASI_Mm01_00264561 predicted 2688
5 SASI_Mm01_00264562 predicted 3858
6 SASI_Mm01_00264563 predicted 4145
7 SASI_Mm01_00264564 predicted 2297
8 SASI_Mm01_00264565 predicted 1944
9 SASI_Mm01_00264566 predicted 3732
10 SASI_Mm01_00264567 predicted 3248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236190 predicted 1091
2 SASI_Mm01_00236191 predicted 497
3 SASI_Mm01_00236192 predicted 1442
4 SASI_Mm01_00236193 predicted 1273
5 SASI_Mm01_00236194 predicted 1002
6 SASI_Mm01_00236195 predicted 643
7 SASI_Mm01_00236196 predicted 653
8 SASI_Mm01_00236197 predicted 1421
9 SASI_Mm01_00236198 predicted 647
10 SASI_Mm01_00236199 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261664 predicted 2322
2 SASI_Mm01_00261665 predicted 1913
3 SASI_Mm01_00261666 predicted 4527
4 SASI_Mm01_00261667 predicted 2622
5 SASI_Mm01_00261668 predicted 3794
6 SASI_Mm01_00261669 predicted 4084
7 SASI_Mm01_00261670 predicted 2237
8 SASI_Mm01_00261671 predicted 1884
9 SASI_Mm01_00261672 predicted 3675
10 SASI_Mm01_00261673 predicted 3184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024940
DOCK5 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4110s1c1
Sequence:CCGGGCTGAGACTTACGAAAGCAAACTCGAGTTTGCTTTCGTAAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-2448s1c1
Sequence:CCGGCGAGTGCTCTACTTGAGATTTCTCGAGAAATCTCAAGTAGAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4907s1c1
Sequence:CCGGGCGACTAATAGCATTACAGATCTCGAGATCTGTAATGCTATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-1268s1c1
Sequence:CCGGGCCACTCACTTCAGTCTTGAACTCGAGTTCAAGACTGAAGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024940.4-7039s1c1
Sequence:CCGGCGGATATTTCTATGCTACTTACTCGAGTAAGTAGCATAGAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-896s21c1
Sequence:CCGGTATCAGTGAGAACTATCTAATCTCGAGATTAGATAGTTCTCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-2590s21c1
Sequence:CCGGAGTACCTTCCTAGCATAATTACTCGAGTAATTATGCTAGGAAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-1968s21c1
Sequence:CCGGCCAAGCAAGGATAGCACTAAACTCGAGTTTAGTGCTATCCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024940
DOCK5 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4110s1c1
Sequence:CCGGGCTGAGACTTACGAAAGCAAACTCGAGTTTGCTTTCGTAAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-2448s1c1
Sequence:CCGGCGAGTGCTCTACTTGAGATTTCTCGAGAAATCTCAAGTAGAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4907s1c1
Sequence:CCGGGCGACTAATAGCATTACAGATCTCGAGATCTGTAATGCTATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-1268s1c1
Sequence:CCGGGCCACTCACTTCAGTCTTGAACTCGAGTTCAAGACTGAAGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024940.4-7039s1c1
Sequence:CCGGCGGATATTTCTATGCTACTTACTCGAGTAAGTAGCATAGAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-896s21c1
Sequence:CCGGTATCAGTGAGAACTATCTAATCTCGAGATTAGATAGTTCTCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-2590s21c1
Sequence:CCGGAGTACCTTCCTAGCATAATTACTCGAGTAATTATGCTAGGAAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-1968s21c1
Sequence:CCGGCCAAGCAAGGATAGCACTAAACTCGAGTTTAGTGCTATCCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024940
DOCK5 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4110s1c1
Sequence:CCGGGCTGAGACTTACGAAAGCAAACTCGAGTTTGCTTTCGTAAGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-2448s1c1
Sequence:CCGGCGAGTGCTCTACTTGAGATTTCTCGAGAAATCTCAAGTAGAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-4907s1c1
Sequence:CCGGGCGACTAATAGCATTACAGATCTCGAGATCTGTAATGCTATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024940.4-1268s1c1
Sequence:CCGGGCCACTCACTTCAGTCTTGAACTCGAGTTCAAGACTGAAGTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024940.4-7039s1c1
Sequence:CCGGCGGATATTTCTATGCTACTTACTCGAGTAAGTAGCATAGAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-896s21c1
Sequence:CCGGTATCAGTGAGAACTATCTAATCTCGAGATTAGATAGTTCTCACTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-2590s21c1
Sequence:CCGGAGTACCTTCCTAGCATAATTACTCGAGTAATTATGCTAGGAAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024940.6-1968s21c1
Sequence:CCGGCCAAGCAAGGATAGCACTAAACTCGAGTTTAGTGCTATCCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177780
VALIDATED
DOCK5 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3949s21c1
Sequence:CCGGGGACATATACATACGGTATTTCTCGAGAAATACCGTATGTATATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-7644s21c1
Sequence:CCGGATTTGCACGGAAGGGTTAATACTCGAGTATTAACCCTTCCGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1807s21c1
Sequence:CCGGACGCTGCCACATACGATTTACCTCGAGGTAAATCGTATGTGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1206s21c1
Sequence:CCGGGAGTAGCAGTGATGGATATTACTCGAGTAATATCCATCACTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3109s21c1
Sequence:CCGGGATTGCCGTCTTACGACAAATCTCGAGATTTGTCGTAAGACGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177780
VALIDATED
DOCK5 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3949s21c1
Sequence:CCGGGGACATATACATACGGTATTTCTCGAGAAATACCGTATGTATATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-7644s21c1
Sequence:CCGGATTTGCACGGAAGGGTTAATACTCGAGTATTAACCCTTCCGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1807s21c1
Sequence:CCGGACGCTGCCACATACGATTTACCTCGAGGTAAATCGTATGTGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1206s21c1
Sequence:CCGGGAGTAGCAGTGATGGATATTACTCGAGTAATATCCATCACTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3109s21c1
Sequence:CCGGGATTGCCGTCTTACGACAAATCTCGAGATTTGTCGTAAGACGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177780
VALIDATED
DOCK5 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3949s21c1
Sequence:CCGGGGACATATACATACGGTATTTCTCGAGAAATACCGTATGTATATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-7644s21c1
Sequence:CCGGATTTGCACGGAAGGGTTAATACTCGAGTATTAACCCTTCCGTGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1807s21c1
Sequence:CCGGACGCTGCCACATACGATTTACCTCGAGGTAAATCGTATGTGGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-1206s21c1
Sequence:CCGGGAGTAGCAGTGATGGATATTACTCGAGTAATATCCATCACTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_177780.3-3109s21c1
Sequence:CCGGGATTGCCGTCTTACGACAAATCTCGAGATTTGTCGTAAGACGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks