EMAIL THIS PAGE TO A FRIEND

DOCK6

dedicator of cytokinesis 6

56 Gene Product Result for
Synonyms: AOS2 ZIR1
UniProtKB ID: Q96HP0, A6H8X5, Q7Z7P4, Q9P2F2
Gene ID:
Human(57572) Summary: This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Mouse(319899) dedicator of cytokinesis 6
Rat(367039) dedicator of cytokinesis 6
sheep(101119818) dedicator of cytokinesis 6
naked mole-rat(101707088) dedicator of cytokinesis 6
domestic guinea pig(100724514) dedicator of cytokinesis 6
Horse(100057307) dedicator of cytokinesis 6
cow(508023) dedicator of cytokinesis 6
domestic cat(101080618) dedicator of cytokinesis 6
dog(611163) dedicator of cytokinesis 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020812 Rosetta Predictions human pricing
NM_001108997 Rosetta Predictions rat pricing
NM_177030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191206 predicted 6002
2 SASI_Hs01_00191208 predicted 4524
3 SASI_Hs01_00191210 predicted 3651
4 SASI_Hs01_00191211 predicted 5506
5 SASI_Hs01_00191212 predicted 3460
6 SASI_Hs02_00354004 predicted 4077
7 SASI_Hs01_00191213 predicted 883
8 SASI_Hs02_00354005 predicted 4989
9 SASI_Hs01_00191215 predicted 418
10 SASI_Hs02_00354006 predicted 5560
11 SASI_Hs01_00191207 predicted 1369
12 SASI_Hs01_00191209 predicted 1971
13 SASI_Hs01_00191214 predicted 3863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244154 predicted 4032
2 SASI_Rn02_00244155 predicted 5341
3 SASI_Rn02_00244156 predicted 869
4 SASI_Rn02_00244157 predicted 1090
5 SASI_Rn02_00244158 predicted 5370
6 SASI_Rn02_00244159 predicted 2235
7 SASI_Rn02_00244160 predicted 1993
8 SASI_Rn02_00244161 predicted 246
9 SASI_Rn02_00244162 predicted 919
10 SASI_Rn02_00244163 predicted 3818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346984 predicted 5468
2 SASI_Mm02_00346985 predicted 5751
3 SASI_Mm02_00346986 predicted 5723
4 SASI_Mm02_00346987 predicted 941
5 SASI_Mm02_00346988 predicted 4706
6 SASI_Mm02_00346989 predicted 1038
7 SASI_Mm02_00346990 predicted 2256
8 SASI_Mm02_00346991 predicted 2010
9 SASI_Mm02_00346992 predicted 1805
10 SASI_Mm02_00346993 predicted 4727
11 SASI_Mm01_00141609 predicted 777
12 SASI_Mm01_00141610 predicted 869
13 SASI_Mm01_00141611 predicted 797
14 SASI_Mm01_00141612 predicted 251
15 SASI_Mm01_00141613 predicted 868
16 SASI_Mm01_00141614 predicted 936
17 SASI_Mm01_00141615 predicted 922
18 SASI_Mm01_00141616 predicted 818
19 SASI_Mm01_00141617 predicted 898
20 SASI_Mm01_00141618 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020812
VALIDATED
DOCK6 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-838s21c1
Sequence:CCGGTGTCGCTCAAGTTCGAGATTGCTCGAGCAATCTCGAACTTGAGCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-1816s21c1
Sequence:CCGGAGTCCAGCTGCAGTGAATTTACTCGAGTAAATTCACTGCAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-5464s1c1
Sequence:CCGGGCCTACATCCAGATCACGTATCTCGAGATACGTGATCTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-1023s1c1
Sequence:CCGGCCTGGTCATCAAGTTGGAGAACTCGAGTTCTCCAACTTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-6168s1c1
Sequence:CCGGCCAAAGCTGTACCTAGAGGAACTCGAGTTCCTCTAGGTACAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-4671s1c1
Sequence:CCGGCCTGATGTTCAACCTGCACATCTCGAGATGTGCAGGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-1554s1c1
Sequence:CCGGGCTGCTTCATATCAAGCCCTACTCGAGTAGGGCTTGATATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020812
VALIDATED
DOCK6 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-838s21c1
Sequence:CCGGTGTCGCTCAAGTTCGAGATTGCTCGAGCAATCTCGAACTTGAGCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-1816s21c1
Sequence:CCGGAGTCCAGCTGCAGTGAATTTACTCGAGTAAATTCACTGCAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-5464s1c1
Sequence:CCGGGCCTACATCCAGATCACGTATCTCGAGATACGTGATCTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-1023s1c1
Sequence:CCGGCCTGGTCATCAAGTTGGAGAACTCGAGTTCTCCAACTTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-6168s1c1
Sequence:CCGGCCAAAGCTGTACCTAGAGGAACTCGAGTTCCTCTAGGTACAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-4671s1c1
Sequence:CCGGCCTGATGTTCAACCTGCACATCTCGAGATGTGCAGGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-1554s1c1
Sequence:CCGGGCTGCTTCATATCAAGCCCTACTCGAGTAGGGCTTGATATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020812
VALIDATED
DOCK6 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-838s21c1
Sequence:CCGGTGTCGCTCAAGTTCGAGATTGCTCGAGCAATCTCGAACTTGAGCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020812.2-1816s21c1
Sequence:CCGGAGTCCAGCTGCAGTGAATTTACTCGAGTAAATTCACTGCAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-5464s1c1
Sequence:CCGGGCCTACATCCAGATCACGTATCTCGAGATACGTGATCTGGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-1023s1c1
Sequence:CCGGCCTGGTCATCAAGTTGGAGAACTCGAGTTCTCCAACTTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020812.1-6168s1c1
Sequence:CCGGCCAAAGCTGTACCTAGAGGAACTCGAGTTCCTCTAGGTACAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-4671s1c1
Sequence:CCGGCCTGATGTTCAACCTGCACATCTCGAGATGTGCAGGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020812.1-1554s1c1
Sequence:CCGGGCTGCTTCATATCAAGCCCTACTCGAGTAGGGCTTGATATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177030
VALIDATED
DOCK6 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-944s21c1
Sequence:CCGGCCTAAACTCGGACTCCGTTAACTCGAGTTAACGGAGTCCGAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-3259s21c1
Sequence:CCGGTAGCGGACCGAGGCTACATTTCTCGAGAAATGTAGCCTCGGTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-5474s21c1
Sequence:CCGGGCGTGTATTTGGGACATATTTCTCGAGAAATATGTCCCAAATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177030.3-6387s21c1
Sequence:CCGGGGCTAAGAGCCACACCCAGAACTCGAGTTCTGGGTGTGGCTCTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-4705s21c1
Sequence:CCGGTGCGCCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-58s1c1
Sequence:CCGGCTCACAAGATCAACAGGACTGCTCGAGCAGTCCTGTTGATCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-258s1c1
Sequence:CCGGGAGTTTCCAGTTGATGACTTACTCGAGTAAGTCATCAACTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177030.2-796s1c1
Sequence:CCGGCCAACATTTATTGGCTGCATACTCGAGTATGCAGCCAATAAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177030
VALIDATED
DOCK6 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-944s21c1
Sequence:CCGGCCTAAACTCGGACTCCGTTAACTCGAGTTAACGGAGTCCGAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-3259s21c1
Sequence:CCGGTAGCGGACCGAGGCTACATTTCTCGAGAAATGTAGCCTCGGTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-5474s21c1
Sequence:CCGGGCGTGTATTTGGGACATATTTCTCGAGAAATATGTCCCAAATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177030.3-6387s21c1
Sequence:CCGGGGCTAAGAGCCACACCCAGAACTCGAGTTCTGGGTGTGGCTCTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-4705s21c1
Sequence:CCGGTGCGCCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-58s1c1
Sequence:CCGGCTCACAAGATCAACAGGACTGCTCGAGCAGTCCTGTTGATCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-258s1c1
Sequence:CCGGGAGTTTCCAGTTGATGACTTACTCGAGTAAGTCATCAACTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177030.2-796s1c1
Sequence:CCGGCCAACATTTATTGGCTGCATACTCGAGTATGCAGCCAATAAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177030
VALIDATED
DOCK6 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-944s21c1
Sequence:CCGGCCTAAACTCGGACTCCGTTAACTCGAGTTAACGGAGTCCGAGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-3259s21c1
Sequence:CCGGTAGCGGACCGAGGCTACATTTCTCGAGAAATGTAGCCTCGGTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177030.3-5474s21c1
Sequence:CCGGGCGTGTATTTGGGACATATTTCTCGAGAAATATGTCCCAAATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177030.3-6387s21c1
Sequence:CCGGGGCTAAGAGCCACACCCAGAACTCGAGTTCTGGGTGTGGCTCTTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_177030.3-4705s21c1
Sequence:CCGGTGCGCCAGAACTTCGAGATTGCTCGAGCAATCTCGAAGTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-58s1c1
Sequence:CCGGCTCACAAGATCAACAGGACTGCTCGAGCAGTCCTGTTGATCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177030.2-258s1c1
Sequence:CCGGGAGTTTCCAGTTGATGACTTACTCGAGTAAGTCATCAACTGGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177030.2-796s1c1
Sequence:CCGGCCAACATTTATTGGCTGCATACTCGAGTATGCAGCCAATAAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks