EMAIL THIS PAGE TO A FRIEND

DOCK7

dedicator of cytokinesis 7

64 Gene Product Result for
Synonyms: ZIR2
Gene ID:
Human(85440) Summary: The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(67299) dedicator of cytokinesis 7
Rat(313388) dedicator of cytokinesis 7
Zebrafish(568817) dedicator of cytokinesis 7
cow(537464) dedicator of cytokinesis 7
Horse(100070382) dedicator of cytokinesis 7
domestic cat(101099738) dedicator of cytokinesis 7
dog(479548) dedicator of cytokinesis 7
chicken(424687) dedicator of cytokinesis 7
domestic guinea pig(100729694) dedicator of cytokinesis 7
naked mole-rat(101718628) dedicator of cytokinesis 7
sheep(101123342) dedicator of cytokinesis 7
Domestic Rabbit(100355634) dedicator of cytokinesis 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033407 Rosetta Predictions human pricing
NM_026082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234091 predicted 5719
2 SASI_Hs01_00234093 predicted 5616
3 SASI_Hs01_00234094 predicted 6173
4 SASI_Hs01_00234095 predicted 3090
5 SASI_Hs02_00361300 predicted 3658
6 SASI_Hs01_00234097 predicted 5682
7 SASI_Hs01_00234098 predicted 6309
8 SASI_Hs02_00361301 predicted 1929
9 SASI_Hs01_00234100 predicted 5900
10 SASI_Hs02_00361302 predicted 6323
11 SASI_Hs01_00234092 predicted 787
12 SASI_Hs01_00234096 predicted 3936
13 SASI_Hs01_00234099 predicted 5311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128688 predicted 471
2 SASI_Mm01_00128689 predicted 5708
3 SASI_Mm01_00128690 predicted 5325
4 SASI_Mm01_00128691 predicted 2558
5 SASI_Mm01_00128692 predicted 4468
6 SASI_Mm01_00128693 predicted 6310
7 SASI_Mm01_00128694 predicted 2688
8 SASI_Mm01_00128695 predicted 5541
9 SASI_Mm01_00128696 predicted 3691
10 SASI_Mm02_00329660 predicted 6405
11 SASI_Mm01_00128697 predicted 5484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026082
VALIDATED
DOCK7 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-2684s1c1
Sequence:CCGGGCCTTTGTTTCAAGGACTTTACTCGAGTAAAGTCCTTGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-3002s1c1
Sequence:CCGGGATGTCATTCTGGAAGCAATACTCGAGTATTGCTTCCAGAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.4-5740s1c1
Sequence:CCGGGATCCAAACAAGGCATATATTCTCGAGAATATATGCCTTGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026082.4-2846s1c1
Sequence:CCGGGCAACAGTAACCCAGATATATCTCGAGATATATCTGGGTTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-5535s21c1
Sequence:CCGGGCGGATGTTTGGCACCTATTTCTCGAGAAATAGGTGCCAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-6632s21c1
Sequence:CCGGGGTAACATGCTGTCATCTTAACTCGAGTTAAGATGACAGCATGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-3786s21c1
Sequence:CCGGCCTACCTCTTATTGGTATTATCTCGAGATAATACCAATAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-2986s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026082
VALIDATED
DOCK7 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-2684s1c1
Sequence:CCGGGCCTTTGTTTCAAGGACTTTACTCGAGTAAAGTCCTTGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-3002s1c1
Sequence:CCGGGATGTCATTCTGGAAGCAATACTCGAGTATTGCTTCCAGAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.4-5740s1c1
Sequence:CCGGGATCCAAACAAGGCATATATTCTCGAGAATATATGCCTTGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026082.4-2846s1c1
Sequence:CCGGGCAACAGTAACCCAGATATATCTCGAGATATATCTGGGTTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-5535s21c1
Sequence:CCGGGCGGATGTTTGGCACCTATTTCTCGAGAAATAGGTGCCAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-6632s21c1
Sequence:CCGGGGTAACATGCTGTCATCTTAACTCGAGTTAAGATGACAGCATGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-3786s21c1
Sequence:CCGGCCTACCTCTTATTGGTATTATCTCGAGATAATACCAATAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-2986s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026082
VALIDATED
DOCK7 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-2684s1c1
Sequence:CCGGGCCTTTGTTTCAAGGACTTTACTCGAGTAAAGTCCTTGAAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.2-3002s1c1
Sequence:CCGGGATGTCATTCTGGAAGCAATACTCGAGTATTGCTTCCAGAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_026082.4-5740s1c1
Sequence:CCGGGATCCAAACAAGGCATATATTCTCGAGAATATATGCCTTGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026082.4-2846s1c1
Sequence:CCGGGCAACAGTAACCCAGATATATCTCGAGATATATCTGGGTTACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-5535s21c1
Sequence:CCGGGCGGATGTTTGGCACCTATTTCTCGAGAAATAGGTGCCAAACATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-6632s21c1
Sequence:CCGGGGTAACATGCTGTCATCTTAACTCGAGTTAAGATGACAGCATGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-3786s21c1
Sequence:CCGGCCTACCTCTTATTGGTATTATCTCGAGATAATACCAATAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026082.4-2986s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033407
VALIDATED
DOCK7 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1572s1c1
Sequence:CCGGGCTTACTTACTCCACCTGCATCTCGAGATGCAGGTGGAGTAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-2703s1c1
Sequence:CCGGCCTGTAACCAAAGTGTAGTTTCTCGAGAAACTACACTTTGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033407.1-3905s1c1
Sequence:CCGGGAGCCATACTTTGACACATATCTCGAGATATGTGTCAAAGTATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-43s1c1
Sequence:CCGGCATGCCGGTAATCTTTGGTAACTCGAGTTACCAAAGATTACCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1675s1c1
Sequence:CCGGGTTTGAATTATCCGTGCCTTTCTCGAGAAAGGCACGGATAATTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-3667s21c1
Sequence:CCGGTCTACCTCTGATTGGTATTATCTCGAGATAATACCAATCAGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033407.2-5654s21c1
Sequence:CCGGGATCCTAACAAGGCATATATTCTCGAGAATATATGCCTTGTTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033407.2-6586s21c1
Sequence:CCGGATGACTCAAAGGTACACTATACTCGAGTATAGTGTACCTTTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-4792s21c1
Sequence:CCGGACGTTCTCTAAAGACTATATTCTCGAGAATATAGTCTTTAGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-2867s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-1530s21c1
Sequence:CCGGTACGGCGACTAAGACCTATTACTCGAGTAATAGGTCTTAGTCGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-5111s21c1
Sequence:CCGGATGCTGGAGGACCGGAAATATCTCGAGATATTTCCGGTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033407
VALIDATED
DOCK7 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1572s1c1
Sequence:CCGGGCTTACTTACTCCACCTGCATCTCGAGATGCAGGTGGAGTAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-2703s1c1
Sequence:CCGGCCTGTAACCAAAGTGTAGTTTCTCGAGAAACTACACTTTGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033407.1-3905s1c1
Sequence:CCGGGAGCCATACTTTGACACATATCTCGAGATATGTGTCAAAGTATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-43s1c1
Sequence:CCGGCATGCCGGTAATCTTTGGTAACTCGAGTTACCAAAGATTACCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1675s1c1
Sequence:CCGGGTTTGAATTATCCGTGCCTTTCTCGAGAAAGGCACGGATAATTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-3667s21c1
Sequence:CCGGTCTACCTCTGATTGGTATTATCTCGAGATAATACCAATCAGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033407.2-5654s21c1
Sequence:CCGGGATCCTAACAAGGCATATATTCTCGAGAATATATGCCTTGTTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033407.2-6586s21c1
Sequence:CCGGATGACTCAAAGGTACACTATACTCGAGTATAGTGTACCTTTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-4792s21c1
Sequence:CCGGACGTTCTCTAAAGACTATATTCTCGAGAATATAGTCTTTAGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-2867s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-1530s21c1
Sequence:CCGGTACGGCGACTAAGACCTATTACTCGAGTAATAGGTCTTAGTCGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-5111s21c1
Sequence:CCGGATGCTGGAGGACCGGAAATATCTCGAGATATTTCCGGTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033407
VALIDATED
DOCK7 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1572s1c1
Sequence:CCGGGCTTACTTACTCCACCTGCATCTCGAGATGCAGGTGGAGTAAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-2703s1c1
Sequence:CCGGCCTGTAACCAAAGTGTAGTTTCTCGAGAAACTACACTTTGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033407.1-3905s1c1
Sequence:CCGGGAGCCATACTTTGACACATATCTCGAGATATGTGTCAAAGTATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-43s1c1
Sequence:CCGGCATGCCGGTAATCTTTGGTAACTCGAGTTACCAAAGATTACCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033407.1-1675s1c1
Sequence:CCGGGTTTGAATTATCCGTGCCTTTCTCGAGAAAGGCACGGATAATTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-3667s21c1
Sequence:CCGGTCTACCTCTGATTGGTATTATCTCGAGATAATACCAATCAGAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033407.2-5654s21c1
Sequence:CCGGGATCCTAACAAGGCATATATTCTCGAGAATATATGCCTTGTTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033407.2-6586s21c1
Sequence:CCGGATGACTCAAAGGTACACTATACTCGAGTATAGTGTACCTTTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-4792s21c1
Sequence:CCGGACGTTCTCTAAAGACTATATTCTCGAGAATATAGTCTTTAGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-2867s21c1
Sequence:CCGGACGGGACGCTTACCAACTAAACTCGAGTTTAGTTGGTAAGCGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-1530s21c1
Sequence:CCGGTACGGCGACTAAGACCTATTACTCGAGTAATAGGTCTTAGTCGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033407.2-5111s21c1
Sequence:CCGGATGCTGGAGGACCGGAAATATCTCGAGATATTTCCGGTCCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks