EMAIL THIS PAGE TO A FRIEND

DOCK8

dedicator of cytokinesis 8

165 Gene Product Result for
Synonyms: MRD2 ZIR8
Gene ID:
Human(81704) Summary: This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
Mouse(76088) dedicator of cytokinesis 8
Rat(499337) dedicator of cytokinesis 8
sheep(101116636) dedicator of cytokinesis 8
Domestic Rabbit(100354750) dedicator of cytokinesis 8
naked mole-rat(101701061) dedicator of cytokinesis 8
domestic guinea pig(100727594) dedicator of cytokinesis 8
Zebrafish(403040) dedicator of cytokinesis 8
chicken(427348) dedicator of cytokinesis 8
dog(476333) dedicator of cytokinesis 8
Horse(100050677) dedicator of cytokinesis 8
cow(100295817) dedicator of cytokinesis 8
domestic cat(101101598) dedicator of cytokinesis 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003218 Anti-DOCK8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203447 Rosetta Predictions human pricing
NM_001037793 Rosetta Predictions rat pricing
XM_001056091 Rosetta Predictions rat pricing
XM_001078906 Rosetta Predictions rat pricing
NM_028785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019472 predicted 3527
2 SASI_Hs02_00373378 predicted 5266
3 SASI_Hs02_00373379 predicted 4290
4 SASI_Hs01_00019476 predicted 5499
5 SASI_Hs02_00373380 predicted 3449
6 SASI_Hs02_00373381 predicted 5889
7 SASI_Hs01_00019477 predicted 1882
8 SASI_Hs01_00019478 predicted 4054
9 SASI_Hs01_00019479 predicted 5118
10 SASI_Hs01_00019481 predicted 4398
11 SASI_Hs01_00019473 predicted 4122
12 SASI_Hs01_00019474 predicted 1572
13 SASI_Hs01_00019475 predicted 4788
14 SASI_Hs01_00019480 predicted 6096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204623 predicted 5555
2 SASI_Rn02_00204624 predicted 304
3 SASI_Rn02_00204625 predicted 6329
4 SASI_Rn02_00204626 predicted 5475
5 SASI_Rn02_00204627 predicted 2194
6 SASI_Rn02_00204628 predicted 1786
7 SASI_Rn02_00204629 predicted 4415
8 SASI_Rn02_00204630 predicted 314
9 SASI_Rn02_00204631 predicted 1962
10 SASI_Rn02_00204632 predicted 3755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281974 predicted 6550
2 SASI_Rn02_00281975 predicted 6591
3 SASI_Rn02_00281976 predicted 6646
4 SASI_Rn02_00281977 predicted 6581
5 SASI_Rn02_00281978 predicted 6459
6 SASI_Rn02_00281979 predicted 6393
7 SASI_Rn02_00281980 predicted 6385
8 SASI_Rn02_00281981 predicted 6425
9 SASI_Rn02_00281982 predicted 6595
10 SASI_Rn02_00281983 predicted 6542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362440 predicted 5792
2 SASI_Rn02_00362441 predicted 533
3 SASI_Rn02_00362442 predicted 6570
4 SASI_Rn02_00362443 predicted 5717
5 SASI_Rn02_00362444 predicted 2435
6 SASI_Rn02_00362445 predicted 2030
7 SASI_Rn02_00362446 predicted 4653
8 SASI_Rn02_00362447 predicted 537
9 SASI_Rn02_00362448 predicted 2207
10 SASI_Rn02_00362449 predicted 3994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150655 predicted 3758
2 SASI_Mm01_00150656 predicted 5500
3 SASI_Mm02_00334390 predicted 980
4 SASI_Mm01_00150657 predicted 2926
5 SASI_Mm02_00334391 predicted 6335
6 SASI_Mm02_00334392 predicted 4740
7 SASI_Mm01_00150658 predicted 1801
8 SASI_Mm01_00150659 predicted 5348
9 SASI_Mm01_00150660 predicted 6324
10 SASI_Mm01_00150661 predicted 1085
11 SASI_Mm01_00150653 predicted 1979
12 SASI_Mm01_00150654 predicted 4746
13 SASI_Mm01_00150662 predicted 2902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028785
VALIDATED
DOCK8 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 8
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-5352s21c1
Sequence:CCGGGGCTTGTACGAGACGGTTAATCTCGAGATTAACCGTCTCGTACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028785.3-1972s1c1
Sequence:CCGGCAGCTATTACATACCATAATACTCGAGTATTATGGTATGTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028785.3-6955s21c1
Sequence:CCGGGACTATGTGCCGTCTAGTTATCTCGAGATAACTAGACGGCACATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-988s21c1
Sequence:CCGGTTGCCCTCTATGACGTTAAAGCTCGAGCTTTAACGTCATAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-4284s21c1
Sequence:CCGGGACCGGTTTCCAGGCATAAATCTCGAGATTTATGCCTGGAAACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-2920s21c1
Sequence:CCGGGCAGCCGGATGTCTTACTATTCTCGAGAATAGTAAGACATCCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028785
VALIDATED
DOCK8 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 8
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-5352s21c1
Sequence:CCGGGGCTTGTACGAGACGGTTAATCTCGAGATTAACCGTCTCGTACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028785.3-1972s1c1
Sequence:CCGGCAGCTATTACATACCATAATACTCGAGTATTATGGTATGTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028785.3-6955s21c1
Sequence:CCGGGACTATGTGCCGTCTAGTTATCTCGAGATAACTAGACGGCACATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-988s21c1
Sequence:CCGGTTGCCCTCTATGACGTTAAAGCTCGAGCTTTAACGTCATAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-4284s21c1
Sequence:CCGGGACCGGTTTCCAGGCATAAATCTCGAGATTTATGCCTGGAAACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-2920s21c1
Sequence:CCGGGCAGCCGGATGTCTTACTATTCTCGAGAATAGTAAGACATCCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028785
VALIDATED
DOCK8 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 8
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-5352s21c1
Sequence:CCGGGGCTTGTACGAGACGGTTAATCTCGAGATTAACCGTCTCGTACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028785.3-1972s1c1
Sequence:CCGGCAGCTATTACATACCATAATACTCGAGTATTATGGTATGTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028785.3-6955s21c1
Sequence:CCGGGACTATGTGCCGTCTAGTTATCTCGAGATAACTAGACGGCACATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028785.3-988s21c1
Sequence:CCGGTTGCCCTCTATGACGTTAAAGCTCGAGCTTTAACGTCATAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-4284s21c1
Sequence:CCGGGACCGGTTTCCAGGCATAAATCTCGAGATTTATGCCTGGAAACCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028785.3-2920s21c1
Sequence:CCGGGCAGCCGGATGTCTTACTATTCTCGAGAATAGTAAGACATCCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203447
DOCK8 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6359s1c1
Sequence:CCGGCCAAATGGACTCTGACCAGATCTCGAGATCTGGTCAGAGTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c2
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203447.1-4148s1c1
Sequence:CCGGCGAGTTAGATCAAGAAGCCTTCTCGAGAAGGCTTCTTGATCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c2
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6638s1c1
Sequence:CCGGCAGGGCAAACTTGTAGGAGTACTCGAGTACTCCTACAAGTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-645s1c1
Sequence:CCGGGCTGTGGAAATACGTCCAGTACTCGAGTACTGGACGTATTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-3542s1c1
Sequence:CCGGCCTACCTTTAGTTGGCATCATCTCGAGATGATGCCAACTAAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c2
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c1
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-185s1c1
Sequence:CCGGGCCAAAGGAATGTAGGACTTTCTCGAGAAAGTCCTACATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c1
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c1
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-1414s1c1
Sequence:CCGGGCTTGCTAAGACTGGAGATTTCTCGAGAAATCTCCAGTCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203447
DOCK8 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6359s1c1
Sequence:CCGGCCAAATGGACTCTGACCAGATCTCGAGATCTGGTCAGAGTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c2
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203447.1-4148s1c1
Sequence:CCGGCGAGTTAGATCAAGAAGCCTTCTCGAGAAGGCTTCTTGATCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c2
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6638s1c1
Sequence:CCGGCAGGGCAAACTTGTAGGAGTACTCGAGTACTCCTACAAGTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-645s1c1
Sequence:CCGGGCTGTGGAAATACGTCCAGTACTCGAGTACTGGACGTATTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-3542s1c1
Sequence:CCGGCCTACCTTTAGTTGGCATCATCTCGAGATGATGCCAACTAAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c2
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c1
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-185s1c1
Sequence:CCGGGCCAAAGGAATGTAGGACTTTCTCGAGAAAGTCCTACATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c1
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c1
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-1414s1c1
Sequence:CCGGGCTTGCTAAGACTGGAGATTTCTCGAGAAATCTCCAGTCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203447
DOCK8 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6359s1c1
Sequence:CCGGCCAAATGGACTCTGACCAGATCTCGAGATCTGGTCAGAGTCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c2
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203447.1-4148s1c1
Sequence:CCGGCGAGTTAGATCAAGAAGCCTTCTCGAGAAGGCTTCTTGATCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c2
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203447.1-6638s1c1
Sequence:CCGGCAGGGCAAACTTGTAGGAGTACTCGAGTACTCCTACAAGTTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-645s1c1
Sequence:CCGGGCTGTGGAAATACGTCCAGTACTCGAGTACTGGACGTATTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-3542s1c1
Sequence:CCGGCCTACCTTTAGTTGGCATCATCTCGAGATGATGCCAACTAAAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c2
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203447.1-6642s1c1
Sequence:CCGGGCAAACTTGTAGGAGTACGAACTCGAGTTCGTACTCCTACAAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-185s1c1
Sequence:CCGGGCCAAAGGAATGTAGGACTTTCTCGAGAAAGTCCTACATTCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-2885s1c1
Sequence:CCGGGCACGTACATAACATGGACAACTCGAGTTGTCCATGTTATGTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-762s1c1
Sequence:CCGGGCCCTCTACGATGTTAAAGAACTCGAGTTCTTTAACATCGTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203447.1-1414s1c1
Sequence:CCGGGCTTGCTAAGACTGGAGATTTCTCGAGAAATCTCCAGTCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175233
DOCK8 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 8
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000202130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2873s1c1
Sequence:CCGGCCTGGATAAACGGGACAGTTTCTCGAGAAACTGTCCCGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2917s1c1
Sequence:CCGGGCTTCAAAGATGACATAACTACTCGAGTAGTTATGTCATCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175233
DOCK8 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 8
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000202130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2873s1c1
Sequence:CCGGCCTGGATAAACGGGACAGTTTCTCGAGAAACTGTCCCGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2917s1c1
Sequence:CCGGGCTTCAAAGATGACATAACTACTCGAGTAGTTATGTCATCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175233
DOCK8 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 8
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000202130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2873s1c1
Sequence:CCGGCCTGGATAAACGGGACAGTTTCTCGAGAAACTGTCCCGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175233.2-2917s1c1
Sequence:CCGGGCTTCAAAGATGACATAACTACTCGAGTAGTTATGTCATCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks