EMAIL THIS PAGE TO A FRIEND

DOCK9

dedicator of cytokinesis 9

228 Gene Product Result for
Synonyms: ZIZ1 ZIZIMIN1
Gene ID:
Mouse(105445) dedicator of cytokinesis 9
Rat(259237) dedicator of cytokinesis 9
Zebrafish(566175) dedicator of cytokinesis 9
cow(616045) dedicator of cytokinesis 9
Horse(100061058) dedicator of cytokinesis 9
domestic cat(101100435) dedicator of cytokinesis 9
chicken(418779) dedicator of cytokinesis 9
dog(612820) dedicator of cytokinesis 9
domestic guinea pig(100713046) dedicator of cytokinesis 9
naked mole-rat(101725596) dedicator of cytokinesis 9
sheep(101110423) dedicator of cytokinesis 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015296 Rosetta Predictions human pricing
NM_001105759 Rosetta Predictions rat pricing
NM_001081039 Rosetta Predictions mouse pricing
NM_001128307 Rosetta Predictions mouse pricing
NM_001128308 Rosetta Predictions mouse pricing
NM_134074 Rosetta Predictions mouse pricing
XM_001004695 Rosetta Predictions mouse pricing
XM_886335 Rosetta Predictions mouse pricing
XM_896647 Rosetta Predictions mouse pricing
XM_896684 Rosetta Predictions mouse pricing
XM_896708 Rosetta Predictions mouse pricing
XM_896809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181942 predicted 2802
2 SASI_Hs01_00181943 predicted 5393
3 SASI_Hs02_00347496 predicted 637
4 SASI_Hs01_00181944 predicted 1963
5 SASI_Hs01_00181945 predicted 5718
6 SASI_Hs01_00181946 predicted 2710
7 SASI_Hs01_00181947 predicted 3585
8 SASI_Hs01_00181949 predicted 3799
9 SASI_Hs01_00181950 predicted 3295
10 SASI_Hs02_00347497 predicted 3103
11 SASI_Hs01_00181948 predicted 3797
12 SASI_Hs01_00181951 predicted 3273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212246 predicted 1867
2 SASI_Rn02_00212247 predicted 2692
3 SASI_Rn02_00212248 predicted 1952
4 SASI_Rn02_00212249 predicted 1314
5 SASI_Rn02_00212250 predicted 1966
6 SASI_Rn02_00212251 predicted 1486
7 SASI_Rn02_00212252 predicted 2160
8 SASI_Rn02_00212253 predicted 1124
9 SASI_Rn02_00212254 predicted 1731
10 SASI_Rn02_00212255 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294581 predicted 718
2 SASI_Mm02_00294582 predicted 1830
3 SASI_Mm02_00294583 predicted 2546
4 SASI_Mm02_00294584 predicted 1922
5 SASI_Mm02_00294585 predicted 2750
6 SASI_Mm02_00294586 predicted 5783
7 SASI_Mm02_00294587 predicted 2834
8 SASI_Mm02_00294588 predicted 3651
9 SASI_Mm02_00294589 predicted 859
10 SASI_Mm02_00294590 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310648 predicted 1117
2 SASI_Mm02_00310649 predicted 2235
3 SASI_Mm02_00310650 predicted 2950
4 SASI_Mm02_00310651 predicted 2325
5 SASI_Mm02_00310652 predicted 3148
6 SASI_Mm02_00310653 predicted 6093
7 SASI_Mm02_00310654 predicted 3242
8 SASI_Mm02_00310655 predicted 4058
9 SASI_Mm02_00310656 predicted 1270
10 SASI_Mm02_00310657 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310658 predicted 1124
2 SASI_Mm02_00310659 predicted 2235
3 SASI_Mm02_00310660 predicted 2943
4 SASI_Mm02_00310661 predicted 2328
5 SASI_Mm02_00310662 predicted 3154
6 SASI_Mm02_00310663 predicted 6048
7 SASI_Mm02_00310664 predicted 3240
8 SASI_Mm02_00310665 predicted 4055
9 SASI_Mm02_00310666 predicted 1265
10 SASI_Mm02_00310667 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339271 predicted 736
2 SASI_Mm02_00339272 predicted 1851
3 SASI_Mm02_00339273 predicted 2561
4 SASI_Mm02_00339274 predicted 1941
5 SASI_Mm02_00339275 predicted 2771
6 SASI_Mm02_00339276 predicted 5633
7 SASI_Mm02_00339277 predicted 2855
8 SASI_Mm02_00339278 predicted 3668
9 SASI_Mm02_00339279 predicted 884
10 SASI_Mm02_00339280 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274863 predicted 6356
2 SASI_Mm01_00274864 predicted 6266
3 SASI_Mm01_00274865 predicted 5781
4 SASI_Mm01_00274866 predicted 6087
5 SASI_Mm01_00274867 predicted 6722
6 SASI_Mm01_00274868 predicted 6213
7 SASI_Mm01_00274869 predicted 5795
8 SASI_Mm01_00274870 predicted 6679
9 SASI_Mm01_00274871 predicted 6666
10 SASI_Mm01_00274872 predicted 6584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258450 predicted 6872
2 SASI_Mm01_00258451 predicted 6077
3 SASI_Mm01_00258452 predicted 6272
4 SASI_Mm01_00258453 predicted 6389
5 SASI_Mm01_00258454 predicted 6089
6 SASI_Mm01_00258455 predicted 6333
7 SASI_Mm01_00258456 predicted 6982
8 SASI_Mm01_00258457 predicted 6977
9 SASI_Mm01_00258458 predicted 6186
10 SASI_Mm01_00258459 predicted 6129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211717 predicted 2400
2 SASI_Mm01_00211718 predicted 2304
3 SASI_Mm01_00211719 predicted 1819
4 SASI_Mm01_00211720 predicted 2126
5 SASI_Mm01_00211721 predicted 2763
6 SASI_Mm01_00211722 predicted 2257
7 SASI_Mm01_00211723 predicted 1829
8 SASI_Mm01_00211724 predicted 2719
9 SASI_Mm01_00211725 predicted 2704
10 SASI_Mm01_00211726 predicted 2619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280013 predicted 2853
2 SASI_Mm01_00280014 predicted 2061
3 SASI_Mm01_00280015 predicted 2251
4 SASI_Mm01_00280016 predicted 2364
5 SASI_Mm01_00280017 predicted 2075
6 SASI_Mm01_00280018 predicted 2314
7 SASI_Mm01_00280019 predicted 2963
8 SASI_Mm01_00280020 predicted 2953
9 SASI_Mm01_00280021 predicted 2165
10 SASI_Mm01_00280022 predicted 2109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249706 predicted 2750
2 SASI_Mm01_00249707 predicted 2656
3 SASI_Mm01_00249708 predicted 2167
4 SASI_Mm01_00249709 predicted 2468
5 SASI_Mm01_00249710 predicted 3106
6 SASI_Mm01_00249711 predicted 2605
7 SASI_Mm01_00249712 predicted 2179
8 SASI_Mm01_00249713 predicted 3065
9 SASI_Mm01_00249714 predicted 3056
10 SASI_Mm01_00249715 predicted 2973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240669 predicted 6670
2 SASI_Mm01_00240670 predicted 5885
3 SASI_Mm01_00240671 predicted 6071
4 SASI_Mm01_00240672 predicted 6187
5 SASI_Mm01_00240673 predicted 5888
6 SASI_Mm01_00240674 predicted 6131
7 SASI_Mm01_00240675 predicted 6791
8 SASI_Mm01_00240676 predicted 6773
9 SASI_Mm01_00240677 predicted 5976
10 SASI_Mm01_00240678 predicted 5925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015296
VALIDATED
DOCK9 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6149s1c1
Sequence:CCGGGCGGTAAACGAACGTCTGATTCTCGAGAATCAGACGTTCGTTTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-7181s1c1
Sequence:CCGGGCTGTTCCAGTATATGCAATACTCGAGTATTGCATATACTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4236s1c1
Sequence:CCGGCCAACATTGCTACTGAGGTTTCTCGAGAAACCTCAGTAGCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-413s1c1
Sequence:CCGGGACTGGCATCTTGTGAACTATCTCGAGATAGTTCACAAGATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015296.1-2991s1c1
Sequence:CCGGCCAAAGTTAAGTTGCTGCGAACTCGAGTTCGCAGCAACTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4716s1c1
Sequence:CCGGCCAACAGTGACCGGCTTATTACTCGAGTAATAAGCCGGTCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-6894s1c1
Sequence:CCGGGTACCAGTGAACCAGGAGATTCTCGAGAATCTCCTGGTTCACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-466s1c1
Sequence:CCGGGCTTCCGAACAAAGTGGTCAACTCGAGTTGACCACTTTGTTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6042s1c1
Sequence:CCGGCGCGAGCTTTCTTAGATGATACTCGAGTATCATCTAAGAAAGCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-4991s1c1
Sequence:CCGGGCAGAATATCTCACACGGAAACTCGAGTTTCCGTGTGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-2585s1c1
Sequence:CCGGGCCTTAGGAAACGAACTTGTACTCGAGTACAAGTTCGTTTCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-2586s1c1
Sequence:CCGGCCTTAGGAAACGAACTTGTAACTCGAGTTACAAGTTCGTTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015296
VALIDATED
DOCK9 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6149s1c1
Sequence:CCGGGCGGTAAACGAACGTCTGATTCTCGAGAATCAGACGTTCGTTTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-7181s1c1
Sequence:CCGGGCTGTTCCAGTATATGCAATACTCGAGTATTGCATATACTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4236s1c1
Sequence:CCGGCCAACATTGCTACTGAGGTTTCTCGAGAAACCTCAGTAGCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-413s1c1
Sequence:CCGGGACTGGCATCTTGTGAACTATCTCGAGATAGTTCACAAGATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015296.1-2991s1c1
Sequence:CCGGCCAAAGTTAAGTTGCTGCGAACTCGAGTTCGCAGCAACTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4716s1c1
Sequence:CCGGCCAACAGTGACCGGCTTATTACTCGAGTAATAAGCCGGTCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-6894s1c1
Sequence:CCGGGTACCAGTGAACCAGGAGATTCTCGAGAATCTCCTGGTTCACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-466s1c1
Sequence:CCGGGCTTCCGAACAAAGTGGTCAACTCGAGTTGACCACTTTGTTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6042s1c1
Sequence:CCGGCGCGAGCTTTCTTAGATGATACTCGAGTATCATCTAAGAAAGCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-4991s1c1
Sequence:CCGGGCAGAATATCTCACACGGAAACTCGAGTTTCCGTGTGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-2585s1c1
Sequence:CCGGGCCTTAGGAAACGAACTTGTACTCGAGTACAAGTTCGTTTCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-2586s1c1
Sequence:CCGGCCTTAGGAAACGAACTTGTAACTCGAGTTACAAGTTCGTTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015296
VALIDATED
DOCK9 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6149s1c1
Sequence:CCGGGCGGTAAACGAACGTCTGATTCTCGAGAATCAGACGTTCGTTTACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-7181s1c1
Sequence:CCGGGCTGTTCCAGTATATGCAATACTCGAGTATTGCATATACTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4236s1c1
Sequence:CCGGCCAACATTGCTACTGAGGTTTCTCGAGAAACCTCAGTAGCAATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-413s1c1
Sequence:CCGGGACTGGCATCTTGTGAACTATCTCGAGATAGTTCACAAGATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015296.1-2991s1c1
Sequence:CCGGCCAAAGTTAAGTTGCTGCGAACTCGAGTTCGCAGCAACTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-4716s1c1
Sequence:CCGGCCAACAGTGACCGGCTTATTACTCGAGTAATAAGCCGGTCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015296.1-6894s1c1
Sequence:CCGGGTACCAGTGAACCAGGAGATTCTCGAGAATCTCCTGGTTCACTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-466s1c1
Sequence:CCGGGCTTCCGAACAAAGTGGTCAACTCGAGTTGACCACTTTGTTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-6042s1c1
Sequence:CCGGCGCGAGCTTTCTTAGATGATACTCGAGTATCATCTAAGAAAGCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-4991s1c1
Sequence:CCGGGCAGAATATCTCACACGGAAACTCGAGTTTCCGTGTGAGATATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015296.1-2585s1c1
Sequence:CCGGGCCTTAGGAAACGAACTTGTACTCGAGTACAAGTTCGTTTCCTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015296.1-2586s1c1
Sequence:CCGGCCTTAGGAAACGAACTTGTAACTCGAGTTACAAGTTCGTTTCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081039
VALIDATED
DOCK9 MISSION shRNA Bacterial Glycerol Stock
dedicator of cytokinesis 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081039.1-715s21c1
Sequence:CCGGTTGGCGATGGATCCTATAATCCTCGAGGATTATAGGATCCATCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2859s21c1
Sequence:CCGGTACGTTGCATCTGAGTATAAGCTCGAGCTTATACTCAGATGCAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-5016s21c1
Sequence:CCGGATGGCGAGGATTCACGTTAAACTCGAGTTTAACGTGAATCCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081039.1-6634s21c1
Sequence:CCGGTAAATCTCACTGGCAATATTTCTCGAGAAATATTGCCAGTGAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2756s21c1
Sequence:CCGGGAACGTGACACGGGTCATTATCTCGAGATAATGACCCGTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081039
VALIDATED
DOCK9 MISSION shRNA shRNA Plasmid DNA
dedicator of cytokinesis 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081039.1-715s21c1
Sequence:CCGGTTGGCGATGGATCCTATAATCCTCGAGGATTATAGGATCCATCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2859s21c1
Sequence:CCGGTACGTTGCATCTGAGTATAAGCTCGAGCTTATACTCAGATGCAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-5016s21c1
Sequence:CCGGATGGCGAGGATTCACGTTAAACTCGAGTTTAACGTGAATCCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081039.1-6634s21c1
Sequence:CCGGTAAATCTCACTGGCAATATTTCTCGAGAAATATTGCCAGTGAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2756s21c1
Sequence:CCGGGAACGTGACACGGGTCATTATCTCGAGATAATGACCCGTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081039
VALIDATED
DOCK9 MISSION shRNA Lentiviral Transduction Particles
dedicator of cytokinesis 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081039.1-715s21c1
Sequence:CCGGTTGGCGATGGATCCTATAATCCTCGAGGATTATAGGATCCATCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2859s21c1
Sequence:CCGGTACGTTGCATCTGAGTATAAGCTCGAGCTTATACTCAGATGCAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-5016s21c1
Sequence:CCGGATGGCGAGGATTCACGTTAAACTCGAGTTTAACGTGAATCCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081039.1-6634s21c1
Sequence:CCGGTAAATCTCACTGGCAATATTTCTCGAGAAATATTGCCAGTGAGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081039.1-2756s21c1
Sequence:CCGGGAACGTGACACGGGTCATTATCTCGAGATAATGACCCGTGTCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks