EMAIL THIS PAGE TO A FRIEND

DOHH

deoxyhypusine hydroxylase/monooxygenase

43 Gene Product Result for
Synonyms: HLRC1 hDOHH
UniProtKB ID: Q9BU89, O75265
Gene ID:
Human(83475) Summary: This gene encodes a metalloenzyme that catalyzes the last step in the conversion of lysine to the unique amino acid hypusine in eukaryotic initiation factor 5A. The encoded protein hydroxylates deoxyhypusine to form hypusine in the mature eukaryotic initiation factor 5A protein. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Mouse(102115) deoxyhypusine hydroxylase/monooxygenase
Rat(314644) deoxyhypusine hydroxylase/monooxygenase
Zebrafish(321732) deoxyhypusine hydroxylase/monooxygenase
chicken(427066) deoxyhypusine hydroxylase/monooxygenase
dog(485060) deoxyhypusine hydroxylase/monooxygenase
cow(526521) deoxyhypusine hydroxylase/monooxygenase
sheep(101117501) deoxyhypusine hydroxylase/monooxygenase
sheep(100135444) deoxyhypusine hydroxylase/monooxygenase
naked mole-rat(101714719) deoxyhypusine hydroxylase/monooxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031304 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093741 MISSION® esiRNA esiRNA targeting mouse Dohh (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031304 Rosetta Predictions human pricing
NM_001025006 Rosetta Predictions rat pricing
NM_133964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019802 predicted 690
2 SASI_Hs01_00019803 predicted 1139
3 SASI_Hs01_00019804 predicted 1134
4 SASI_Hs01_00019805 predicted 460
5 SASI_Hs01_00019806 predicted 1136
6 SASI_Hs01_00019807 predicted 1146
7 SASI_Hs01_00019808 predicted 471
8 SASI_Hs01_00019809 predicted 337
9 SASI_Hs01_00019810 predicted 1118
10 SASI_Hs01_00019811 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107685 predicted 986
2 SASI_Rn01_00107686 predicted 227
3 SASI_Rn01_00107687 predicted 647
4 SASI_Rn01_00107688 predicted 235
5 SASI_Rn01_00107689 predicted 263
6 SASI_Rn01_00107690 predicted 932
7 SASI_Rn01_00107691 predicted 1170
8 SASI_Rn01_00107692 predicted 937
9 SASI_Rn01_00107693 predicted 642
10 SASI_Rn01_00107694 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187742 predicted 649
2 SASI_Mm01_00187743 predicted 645
3 SASI_Mm01_00187744 predicted 548
4 SASI_Mm01_00187745 predicted 231
5 SASI_Mm01_00187746 predicted 650
6 SASI_Mm01_00187747 predicted 227
7 SASI_Mm01_00187748 predicted 446
8 SASI_Mm02_00339082 predicted 796
9 SASI_Mm01_00187749 predicted 259
10 SASI_Mm01_00187750 predicted 432
11 SASI_Mm01_00187751 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133964
VALIDATED
DOHH MISSION shRNA Bacterial Glycerol Stock
deoxyhypusine hydroxylase/monooxygenase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-1099s21c1
Sequence:CCGGCTGTGCCTCACATCCAGGTTTCTCGAGAAACCTGGATGTGAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-953s21c1
Sequence:CCGGCCCTGGACATGTATGAGTATGCTCGAGCATACTCATACATGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-647s21c1
Sequence:CCGGAGCGATACCGTGCCATGTTTGCTCGAGCAAACATGGCACGGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-412s21c1
Sequence:CCGGGCGATTGGTAACCCGGAAGTTCTCGAGAACTTCCGGGTTACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-434s21c1
Sequence:CCGGTAGGCCTCCTGAAGCAGTATTCTCGAGAATACTGCTTCAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-233s1c1
Sequence:CCGGCTGATGCTATCTCGTGGATCACTCGAGTGATCCACGAGATAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-414s1c1
Sequence:CCGGGATTGGTAACCCGGAAGTTCTCTCGAGAGAACTTCCGGGTTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133964
VALIDATED
DOHH MISSION shRNA shRNA Plasmid DNA
deoxyhypusine hydroxylase/monooxygenase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-1099s21c1
Sequence:CCGGCTGTGCCTCACATCCAGGTTTCTCGAGAAACCTGGATGTGAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-953s21c1
Sequence:CCGGCCCTGGACATGTATGAGTATGCTCGAGCATACTCATACATGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-647s21c1
Sequence:CCGGAGCGATACCGTGCCATGTTTGCTCGAGCAAACATGGCACGGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-412s21c1
Sequence:CCGGGCGATTGGTAACCCGGAAGTTCTCGAGAACTTCCGGGTTACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-434s21c1
Sequence:CCGGTAGGCCTCCTGAAGCAGTATTCTCGAGAATACTGCTTCAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-233s1c1
Sequence:CCGGCTGATGCTATCTCGTGGATCACTCGAGTGATCCACGAGATAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-414s1c1
Sequence:CCGGGATTGGTAACCCGGAAGTTCTCTCGAGAGAACTTCCGGGTTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133964
VALIDATED
DOHH MISSION shRNA Lentiviral Transduction Particles
deoxyhypusine hydroxylase/monooxygenase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-1099s21c1
Sequence:CCGGCTGTGCCTCACATCCAGGTTTCTCGAGAAACCTGGATGTGAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-953s21c1
Sequence:CCGGCCCTGGACATGTATGAGTATGCTCGAGCATACTCATACATGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-647s21c1
Sequence:CCGGAGCGATACCGTGCCATGTTTGCTCGAGCAAACATGGCACGGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-412s21c1
Sequence:CCGGGCGATTGGTAACCCGGAAGTTCTCGAGAACTTCCGGGTTACCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133964.1-434s21c1
Sequence:CCGGTAGGCCTCCTGAAGCAGTATTCTCGAGAATACTGCTTCAGGAGGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-233s1c1
Sequence:CCGGCTGATGCTATCTCGTGGATCACTCGAGTGATCCACGAGATAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133964.1-414s1c1
Sequence:CCGGGATTGGTAACCCGGAAGTTCTCTCGAGAGAACTTCCGGGTTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031304
DOHH MISSION shRNA Bacterial Glycerol Stock
deoxyhypusine hydroxylase/monooxygenase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-984s21c1
Sequence:CCGGAGGTGGCTCTGGACATGTATGCTCGAGCATACATGTCCAGAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-273s21c1
Sequence:CCGGCAGGCGCCATTGCATGGATCACTCGAGTGATCCATGCAATGGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-295s21c1
Sequence:CCGGCCAGGCCTTCGATGACGATTCCTCGAGGAATCGTCATCGAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-475s21c1
Sequence:CCGGGGAGATCCTGAAGCAGTATTCCTCGAGGAATACTGCTTCAGGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031304.3-1126s21c1
Sequence:CCGGCGCAGAGCTTTGGCGTCTAAACTCGAGTTTAGACGCCAAAGCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031304
DOHH MISSION shRNA shRNA Plasmid DNA
deoxyhypusine hydroxylase/monooxygenase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-984s21c1
Sequence:CCGGAGGTGGCTCTGGACATGTATGCTCGAGCATACATGTCCAGAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-273s21c1
Sequence:CCGGCAGGCGCCATTGCATGGATCACTCGAGTGATCCATGCAATGGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-295s21c1
Sequence:CCGGCCAGGCCTTCGATGACGATTCCTCGAGGAATCGTCATCGAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-475s21c1
Sequence:CCGGGGAGATCCTGAAGCAGTATTCCTCGAGGAATACTGCTTCAGGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031304.3-1126s21c1
Sequence:CCGGCGCAGAGCTTTGGCGTCTAAACTCGAGTTTAGACGCCAAAGCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031304
DOHH MISSION shRNA Lentiviral Transduction Particles
deoxyhypusine hydroxylase/monooxygenase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-984s21c1
Sequence:CCGGAGGTGGCTCTGGACATGTATGCTCGAGCATACATGTCCAGAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-273s21c1
Sequence:CCGGCAGGCGCCATTGCATGGATCACTCGAGTGATCCATGCAATGGCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-295s21c1
Sequence:CCGGCCAGGCCTTCGATGACGATTCCTCGAGGAATCGTCATCGAAGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031304.3-475s21c1
Sequence:CCGGGGAGATCCTGAAGCAGTATTCCTCGAGGAATACTGCTTCAGGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031304.3-1126s21c1
Sequence:CCGGCGCAGAGCTTTGGCGTCTAAACTCGAGTTTAGACGCCAAAGCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks