EMAIL THIS PAGE TO A FRIEND

DOK1

docking protein 1, 62kDa (downstream of tyrosine kinase 1)

57 Gene Product Result for
Synonyms: P62DOK
UniProtKB ID: Q99704, O43204, Q53TY2, Q9UHG6
Gene ID:
Human(1796) Summary: The protein encoded by this gene is part of a signal transduction pathway downstream of receptor tyrosine kinases. The encoded protein is a scaffold protein that helps form a platform for the assembly of multiprotein signaling complexes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(13448) docking protein 1
Rat(312477) docking protein 1
chicken(430423) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
domestic cat(101088660) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
cow(514962) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
dog(483100) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
domestic guinea pig(100733501) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
naked mole-rat(101724520) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
sheep(101120650) docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300520 Anti-DOK1 (Ab-362) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300521 Anti-DOK1 (Ab-398) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
AV09001 Anti-DOK1 antibody produced in rabbit affinity isolated antibody horse, human
western blot pricing
HPA048561 Anti-DOK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500666 Anti-P62 DOK antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500667 Anti-P62 DOK, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
P3735 Anti-p62dok antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300218 Anti-phospho-DOK1 (pTyr362) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300219 Anti-phospho-DOK1 (pTyr398) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504379 Anti-phospho-p62 Dok (pTyr362) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504380 Anti-phospho-p62 Dok (pTyr398) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001381 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001381 Rosetta Predictions human pricing
NM_001025416 Rosetta Predictions rat pricing
NM_010070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180891 predicted 1019
2 SASI_Hs01_00180892 predicted 1512
3 SASI_Hs01_00180894 predicted 392
4 SASI_Hs01_00180895 predicted 925
5 SASI_Hs01_00180896 predicted 1613
6 SASI_Hs01_00180898 predicted 385
7 SASI_Hs01_00180899 predicted 941
8 SASI_Hs01_00180900 predicted 1097
9 SASI_Hs02_00331734 predicted 359
10 SASI_Hs02_00331735 predicted 1512
11 SASI_Hs01_00180893 predicted 1610
12 SASI_Hs01_00180897 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090325 predicted 1002
2 SASI_Rn02_00203153 predicted 215
3 SASI_Rn01_00090326 predicted 1386
4 SASI_Rn01_00090327 predicted 893
5 SASI_Rn01_00090328 predicted 208
6 SASI_Rn01_00090329 predicted 910
7 SASI_Rn01_00090330 predicted 554
8 SASI_Rn01_00090331 predicted 1392
9 SASI_Rn01_00090332 predicted 516
10 SASI_Rn01_00090333 predicted 557
11 SASI_Rn01_00090324 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118202 predicted 911
2 SASI_Mm01_00118204 predicted 1316
3 SASI_Mm01_00118205 predicted 931
4 SASI_Mm01_00118206 predicted 541
5 SASI_Mm01_00118207 predicted 588
6 SASI_Mm01_00118208 predicted 235
7 SASI_Mm01_00118209 predicted 1419
8 SASI_Mm01_00118210 predicted 1117
9 SASI_Mm01_00118211 predicted 1432
10 SASI_Mm02_00317752 predicted 241
11 SASI_Mm01_00118203 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010070
VALIDATED
DOK1 MISSION shRNA Bacterial Glycerol Stock
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-926s1c1
Sequence:CCGGGCCTTTAGACTCCTTGCGAATCTCGAGATTCGCAAGGAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-152s1c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010070.3-1110s1c1
Sequence:CCGGCCCATCTATGATGAACCTGAACTCGAGTTCAGGTTCATCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-1364s1c1
Sequence:CCGGCAGCTCAGATACAGCTCTGTACTCGAGTACAGAGCTGTATCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-602s21c1
Sequence:CCGGTTTGGGTGCGCAGAGTCAAATCTCGAGATTTGACTCTGCGCACCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-158s21c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-547s21c1
Sequence:CCGGGCTTGCAAGGCTCCTACATACCTCGAGGTATGTAGGAGCCTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-1425s21c1
Sequence:CCGGTGGGACTGTGGACTCTCTAAACTCGAGTTTAGAGAGTCCACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010070.4-1496s21c1
Sequence:CCGGTTGCTGATAGGAGGTCCAATGCTCGAGCATTGGACCTCCTATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010070
VALIDATED
DOK1 MISSION shRNA shRNA Plasmid DNA
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-926s1c1
Sequence:CCGGGCCTTTAGACTCCTTGCGAATCTCGAGATTCGCAAGGAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-152s1c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010070.3-1110s1c1
Sequence:CCGGCCCATCTATGATGAACCTGAACTCGAGTTCAGGTTCATCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-1364s1c1
Sequence:CCGGCAGCTCAGATACAGCTCTGTACTCGAGTACAGAGCTGTATCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-602s21c1
Sequence:CCGGTTTGGGTGCGCAGAGTCAAATCTCGAGATTTGACTCTGCGCACCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-158s21c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-547s21c1
Sequence:CCGGGCTTGCAAGGCTCCTACATACCTCGAGGTATGTAGGAGCCTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-1425s21c1
Sequence:CCGGTGGGACTGTGGACTCTCTAAACTCGAGTTTAGAGAGTCCACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010070.4-1496s21c1
Sequence:CCGGTTGCTGATAGGAGGTCCAATGCTCGAGCATTGGACCTCCTATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010070
VALIDATED
DOK1 MISSION shRNA Lentiviral Transduction Particles
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-926s1c1
Sequence:CCGGGCCTTTAGACTCCTTGCGAATCTCGAGATTCGCAAGGAGTCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-152s1c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010070.3-1110s1c1
Sequence:CCGGCCCATCTATGATGAACCTGAACTCGAGTTCAGGTTCATCATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010070.3-1364s1c1
Sequence:CCGGCAGCTCAGATACAGCTCTGTACTCGAGTACAGAGCTGTATCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-602s21c1
Sequence:CCGGTTTGGGTGCGCAGAGTCAAATCTCGAGATTTGACTCTGCGCACCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-158s21c1
Sequence:CCGGGCTGGAATTCTTTGATCACAACTCGAGTTGTGATCAAAGAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-547s21c1
Sequence:CCGGGCTTGCAAGGCTCCTACATACCTCGAGGTATGTAGGAGCCTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010070.4-1425s21c1
Sequence:CCGGTGGGACTGTGGACTCTCTAAACTCGAGTTTAGAGAGTCCACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010070.4-1496s21c1
Sequence:CCGGTTGCTGATAGGAGGTCCAATGCTCGAGCATTGGACCTCCTATCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001381
VALIDATED
DOK1 MISSION shRNA Bacterial Glycerol Stock
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1025s1c1
Sequence:CCGGCCTCTCTATTGGGACTTGTATCTCGAGATACAAGTCCCAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-139s1c1
Sequence:CCGGGCTCGAGTTCTTTGACCATAACTCGAGTTATGGTCAAAGAACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-403s1c1
Sequence:CCGGGCCTACCGATAACCCACCTAACTCGAGTTAGGTGGGTTATCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-1004s1c1
Sequence:CCGGGAGGGAGTACAACGGAAGAAACTCGAGTTTCTTCCGTTGTACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1088s1c1
Sequence:CCGGCCCAAAGAGGATCCCATCTATCTCGAGATAGATGGGATCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001381
VALIDATED
DOK1 MISSION shRNA shRNA Plasmid DNA
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1025s1c1
Sequence:CCGGCCTCTCTATTGGGACTTGTATCTCGAGATACAAGTCCCAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-139s1c1
Sequence:CCGGGCTCGAGTTCTTTGACCATAACTCGAGTTATGGTCAAAGAACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-403s1c1
Sequence:CCGGGCCTACCGATAACCCACCTAACTCGAGTTAGGTGGGTTATCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-1004s1c1
Sequence:CCGGGAGGGAGTACAACGGAAGAAACTCGAGTTTCTTCCGTTGTACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1088s1c1
Sequence:CCGGCCCAAAGAGGATCCCATCTATCTCGAGATAGATGGGATCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001381
VALIDATED
DOK1 MISSION shRNA Lentiviral Transduction Particles
docking protein 1, 62kDa (downstream of tyrosine kinase 1)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1025s1c1
Sequence:CCGGCCTCTCTATTGGGACTTGTATCTCGAGATACAAGTCCCAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-139s1c1
Sequence:CCGGGCTCGAGTTCTTTGACCATAACTCGAGTTATGGTCAAAGAACTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-403s1c1
Sequence:CCGGGCCTACCGATAACCCACCTAACTCGAGTTAGGTGGGTTATCGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001381.2-1004s1c1
Sequence:CCGGGAGGGAGTACAACGGAAGAAACTCGAGTTTCTTCCGTTGTACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001381.2-1088s1c1
Sequence:CCGGCCCAAAGAGGATCCCATCTATCTCGAGATAGATGGGATCCTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks