EMAIL THIS PAGE TO A FRIEND

DOK2

docking protein 2, 56kDa

48 Gene Product Result for
Synonyms: p56DOK p56dok-2
UniProtKB ID: O60496, Q8N5A4
Gene ID:
Human(9046) Summary: The protein encoded by this gene is constitutively tyrosine phosphorylated in hematopoietic progenitors isolated from chronic myelogenous leukemia (CML) patients in the chronic phase. It may be a critical substrate for p210(bcr/abl), a chimeric protein whose presence is associated with CML. This encoded protein binds p120 (RasGAP) from CML cells. [provided by RefSeq, Jul 2008]
Mouse(13449) docking protein 2
Rat(290361) docking protein 2
Zebrafish(100001537) docking protein 2
dog(486133) docking protein 2, 56kDa
domestic cat(101094341) docking protein 2, 56kDa
cow(514616) docking protein 2, 56kDa
Horse(100053679) docking protein 2, 56kDa
chicken(100857332) docking protein 2, 56kDa
sheep(101119612) docking protein 2, 56kDa
naked mole-rat(101706737) docking protein 2, 56kDa
domestic guinea pig(100725807) docking protein 2, 56kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300522 Anti-DOK2 (Ab-299) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
AV09025 Anti-DOK2 antibody produced in rabbit affinity isolated antibody bovine, mouse, human, rat
western blot pricing
SAB4503534 Anti-p56 DOK-3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300220 Anti-phospho-DOK2 (pTyr299) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504381 Anti-phospho-p56 Dok-2 (pTyr299) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003974 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033811 MISSION® esiRNA esiRNA targeting mouse Dok2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003974 Rosetta Predictions human pricing
NM_001106048 Rosetta Predictions rat pricing
NM_010071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223923 predicted 1277
2 SASI_Hs01_00223924 predicted 693
3 SASI_Hs01_00223925 predicted 230
4 SASI_Hs02_00336666 predicted 745
5 SASI_Hs01_00223926 predicted 1068
6 SASI_Hs01_00223927 predicted 1103
7 SASI_Hs01_00223928 predicted 754
8 SASI_Hs01_00223929 predicted 655
9 SASI_Hs01_00223930 predicted 917
10 SASI_Hs01_00223931 predicted 1482
11 SASI_Hs01_00223932 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215112 predicted 967
2 SASI_Rn02_00215113 predicted 1083
3 SASI_Rn02_00215114 predicted 1208
4 SASI_Rn02_00215115 predicted 963
5 SASI_Rn02_00215116 predicted 615
6 SASI_Rn02_00215117 predicted 378
7 SASI_Rn02_00215118 predicted 1235
8 SASI_Rn02_00215119 predicted 891
9 SASI_Rn02_00215120 predicted 956
10 SASI_Rn02_00215121 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074320 predicted 779
2 SASI_Mm01_00074321 predicted 664
3 SASI_Mm01_00074322 predicted 223
4 SASI_Mm01_00074323 predicted 717
5 SASI_Mm01_00074324 predicted 736
6 SASI_Mm01_00074325 predicted 1100
7 SASI_Mm01_00074326 predicted 731
8 SASI_Mm01_00074327 predicted 460
9 SASI_Mm01_00074328 predicted 1090
10 SASI_Mm01_00074329 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010071
DOK2 MISSION shRNA Bacterial Glycerol Stock
docking protein 2, 56kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-498s21c1
Sequence:CCGGAGGGCTCTGCAAGGAATATATCTCGAGATATATTCCTTGCAGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-620s21c1
Sequence:CCGGAGCCAGGCACACAGCTATATGCTCGAGCATATAGCTGTGTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010071.1-1541s1c1
Sequence:CCGGCCATTTCTCTTAAGAGACAAACTCGAGTTTGTCTCTTAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1051s1c1
Sequence:CCGGGACCCACTGTATGACAGCATTCTCGAGAATGCTGTCATACAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-648s1c1
Sequence:CCGGCTACAGGTTTCTTCGACGCTTCTCGAGAAGCGTCGAAGAAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1255s1c1
Sequence:CCGGACTGAGTATGACAATGTCATACTCGAGTATGACATTGTCATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-148s1c1
Sequence:CCGGGCCGTGTTATATGGAGAGTCTCTCGAGAGACTCTCCATATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010071
DOK2 MISSION shRNA shRNA Plasmid DNA
docking protein 2, 56kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-498s21c1
Sequence:CCGGAGGGCTCTGCAAGGAATATATCTCGAGATATATTCCTTGCAGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-620s21c1
Sequence:CCGGAGCCAGGCACACAGCTATATGCTCGAGCATATAGCTGTGTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010071.1-1541s1c1
Sequence:CCGGCCATTTCTCTTAAGAGACAAACTCGAGTTTGTCTCTTAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1051s1c1
Sequence:CCGGGACCCACTGTATGACAGCATTCTCGAGAATGCTGTCATACAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-648s1c1
Sequence:CCGGCTACAGGTTTCTTCGACGCTTCTCGAGAAGCGTCGAAGAAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1255s1c1
Sequence:CCGGACTGAGTATGACAATGTCATACTCGAGTATGACATTGTCATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-148s1c1
Sequence:CCGGGCCGTGTTATATGGAGAGTCTCTCGAGAGACTCTCCATATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010071
DOK2 MISSION shRNA Lentiviral Transduction Particles
docking protein 2, 56kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-498s21c1
Sequence:CCGGAGGGCTCTGCAAGGAATATATCTCGAGATATATTCCTTGCAGAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010071.2-620s21c1
Sequence:CCGGAGCCAGGCACACAGCTATATGCTCGAGCATATAGCTGTGTGCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010071.1-1541s1c1
Sequence:CCGGCCATTTCTCTTAAGAGACAAACTCGAGTTTGTCTCTTAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1051s1c1
Sequence:CCGGGACCCACTGTATGACAGCATTCTCGAGAATGCTGTCATACAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-648s1c1
Sequence:CCGGCTACAGGTTTCTTCGACGCTTCTCGAGAAGCGTCGAAGAAACCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-1255s1c1
Sequence:CCGGACTGAGTATGACAATGTCATACTCGAGTATGACATTGTCATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010071.1-148s1c1
Sequence:CCGGGCCGTGTTATATGGAGAGTCTCTCGAGAGACTCTCCATATAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003974
DOK2 MISSION shRNA Bacterial Glycerol Stock
docking protein 2, 56kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1111s1c1
Sequence:CCGGCGACCTGACCACATATACGATCTCGAGATCGTATATGTGGTCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-754s1c1
Sequence:CCGGGAGGGCAACTTTGAGTTCGAACTCGAGTTCGAACTCAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1284s1c1
Sequence:CCGGGCCAGGAACTGAGTATGACAACTCGAGTTGTCATACTCAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1289s1c1
Sequence:CCGGGAACTGAGTATGACAATGTTGCTCGAGCAACATTGTCATACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-537s1c1
Sequence:CCGGCAAGGAATTTGCTGTGACCATCTCGAGATGGTCACAGCAAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-541s1c1
Sequence:CCGGGAATTTGCTGTGACCATGAGACTCGAGTCTCATGGTCACAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1306s1c1
Sequence:CCGGGTTGTACTAAAGAAAGGCCCACTCGAGTGGGCCTTTCTTTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1285s1c1
Sequence:CCGGCCAGGAACTGAGTATGACAATCTCGAGATTGTCATACTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-120s1c1
Sequence:CCGGCTTCTTGTATCTTCAGCAGCACTCGAGTGCTGCTGAAGATACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-780s1c1
Sequence:CCGGGCAAGGCAATGAGATCTTCTTCTCGAGAAGAAGATCTCATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1720s1c1
Sequence:CCGGGCTTCCTGCACCTTTCAGATTCTCGAGAATCTGAAAGGTGCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1456s1c1
Sequence:CCGGGCTGATAAATTGCCTCTCCCACTCGAGTGGGAGAGGCAATTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-550s1c1
Sequence:CCGGGTGACCATGAGACCTACAGAACTCGAGTTCTGTAGGTCTCATGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003974
DOK2 MISSION shRNA shRNA Plasmid DNA
docking protein 2, 56kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1111s1c1
Sequence:CCGGCGACCTGACCACATATACGATCTCGAGATCGTATATGTGGTCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-754s1c1
Sequence:CCGGGAGGGCAACTTTGAGTTCGAACTCGAGTTCGAACTCAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1284s1c1
Sequence:CCGGGCCAGGAACTGAGTATGACAACTCGAGTTGTCATACTCAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1289s1c1
Sequence:CCGGGAACTGAGTATGACAATGTTGCTCGAGCAACATTGTCATACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-537s1c1
Sequence:CCGGCAAGGAATTTGCTGTGACCATCTCGAGATGGTCACAGCAAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-541s1c1
Sequence:CCGGGAATTTGCTGTGACCATGAGACTCGAGTCTCATGGTCACAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1306s1c1
Sequence:CCGGGTTGTACTAAAGAAAGGCCCACTCGAGTGGGCCTTTCTTTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1285s1c1
Sequence:CCGGCCAGGAACTGAGTATGACAATCTCGAGATTGTCATACTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-120s1c1
Sequence:CCGGCTTCTTGTATCTTCAGCAGCACTCGAGTGCTGCTGAAGATACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-780s1c1
Sequence:CCGGGCAAGGCAATGAGATCTTCTTCTCGAGAAGAAGATCTCATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1720s1c1
Sequence:CCGGGCTTCCTGCACCTTTCAGATTCTCGAGAATCTGAAAGGTGCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1456s1c1
Sequence:CCGGGCTGATAAATTGCCTCTCCCACTCGAGTGGGAGAGGCAATTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-550s1c1
Sequence:CCGGGTGACCATGAGACCTACAGAACTCGAGTTCTGTAGGTCTCATGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003974
DOK2 MISSION shRNA Lentiviral Transduction Particles
docking protein 2, 56kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1111s1c1
Sequence:CCGGCGACCTGACCACATATACGATCTCGAGATCGTATATGTGGTCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-754s1c1
Sequence:CCGGGAGGGCAACTTTGAGTTCGAACTCGAGTTCGAACTCAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1284s1c1
Sequence:CCGGGCCAGGAACTGAGTATGACAACTCGAGTTGTCATACTCAGTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1289s1c1
Sequence:CCGGGAACTGAGTATGACAATGTTGCTCGAGCAACATTGTCATACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-537s1c1
Sequence:CCGGCAAGGAATTTGCTGTGACCATCTCGAGATGGTCACAGCAAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-541s1c1
Sequence:CCGGGAATTTGCTGTGACCATGAGACTCGAGTCTCATGGTCACAGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1306s1c1
Sequence:CCGGGTTGTACTAAAGAAAGGCCCACTCGAGTGGGCCTTTCTTTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-1285s1c1
Sequence:CCGGCCAGGAACTGAGTATGACAATCTCGAGATTGTCATACTCAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-120s1c1
Sequence:CCGGCTTCTTGTATCTTCAGCAGCACTCGAGTGCTGCTGAAGATACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-780s1c1
Sequence:CCGGGCAAGGCAATGAGATCTTCTTCTCGAGAAGAAGATCTCATTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1720s1c1
Sequence:CCGGGCTTCCTGCACCTTTCAGATTCTCGAGAATCTGAAAGGTGCAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003974.2-1456s1c1
Sequence:CCGGGCTGATAAATTGCCTCTCCCACTCGAGTGGGAGAGGCAATTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003974.2-550s1c1
Sequence:CCGGGTGACCATGAGACCTACAGAACTCGAGTTCTGTAGGTCTCATGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks