EMAIL THIS PAGE TO A FRIEND

DOK3

docking protein 3

49 Gene Product Result for
Synonyms: DOKL
UniProtKB ID: Q7L591, E9PAT0, H7BXS0, Q8N864, Q9BQB3, Q9H666
Gene ID:
Mouse(27261) docking protein 3
Rat(306760) docking protein 3
domestic guinea pig(100729277) docking protein 3
naked mole-rat(101715135) docking protein 3
sheep(101107279) docking protein 3
chicken(429960) docking protein 3
domestic cat(101086625) docking protein 3
cow(514894) docking protein 3
dog(489087) docking protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024872 Rosetta Predictions human pricing
NM_001107336 Rosetta Predictions rat pricing
NM_013739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015737 predicted 212
2 SASI_Hs01_00015738 predicted 1171
3 SASI_Hs01_00015739 predicted 639
4 SASI_Hs01_00015740 predicted 772
5 SASI_Hs01_00015741 predicted 562
6 SASI_Hs01_00015742 predicted 1117
7 SASI_Hs01_00015743 predicted 1173
8 SASI_Hs01_00015745 predicted 467
9 SASI_Hs02_00357464 predicted 224
10 SASI_Hs02_00357465 predicted 1345
11 SASI_Hs01_00015744 predicted 1283
12 SASI_Hs01_00015746 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227835 predicted 394
2 SASI_Rn02_00227836 predicted 229
3 SASI_Rn02_00227837 predicted 469
4 SASI_Rn02_00227838 predicted 905
5 SASI_Rn02_00227839 predicted 577
6 SASI_Rn02_00227840 predicted 233
7 SASI_Rn02_00227841 predicted 649
8 SASI_Rn02_00227842 predicted 384
9 SASI_Rn02_00227843 predicted 550
10 SASI_Rn02_00227844 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100284 predicted 394
2 SASI_Mm02_00322680 predicted 292
3 SASI_Mm01_00100285 predicted 230
4 SASI_Mm02_00322681 predicted 1054
5 SASI_Mm01_00100287 predicted 1145
6 SASI_Mm02_00322682 predicted 501
7 SASI_Mm01_00100288 predicted 499
8 SASI_Mm01_00100289 predicted 468
9 SASI_Mm01_00100290 predicted 554
10 SASI_Mm02_00322683 predicted 571
11 SASI_Mm01_00100286 predicted 398
12 SASI_Mm01_00100291 predicted 1153
13 SASI_Mm01_00100292 predicted 589
14 SASI_Mm01_00100293 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024872
DOK3 MISSION shRNA Bacterial Glycerol Stock
docking protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-213s1c1
Sequence:CCGGGCAGCATGTCAAGTTTGGCAACTCGAGTTGCCAAACTTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-216s1c1
Sequence:CCGGGCATGTCAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-1179s1c1
Sequence:CCGGCAATGAGCACCTCTATGAGAACTCGAGTTCTCATAGAGGTGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1404s21c1
Sequence:CCGGTGACCCTCAGGCAGGTTTCAACTCGAGTTGAAACCTGCCTGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1177s21c1
Sequence:CCGGGGCAATGAGCACCTCTATGAGCTCGAGCTCATAGAGGTGCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024872.1-1547s21c1
Sequence:CCGGTGGGCTGGTGGGCAAACATTGCTCGAGCAATGTTTGCCCACCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-209s21c1
Sequence:CCGGACCAGCAGCATGTCAAGTTTGCTCGAGCAAACTTGACATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1280s21c1
Sequence:CCGGCAACCAGTCCCATCTACCACACTCGAGTGTGGTAGATGGGACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024872
DOK3 MISSION shRNA shRNA Plasmid DNA
docking protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-213s1c1
Sequence:CCGGGCAGCATGTCAAGTTTGGCAACTCGAGTTGCCAAACTTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-216s1c1
Sequence:CCGGGCATGTCAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-1179s1c1
Sequence:CCGGCAATGAGCACCTCTATGAGAACTCGAGTTCTCATAGAGGTGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1404s21c1
Sequence:CCGGTGACCCTCAGGCAGGTTTCAACTCGAGTTGAAACCTGCCTGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1177s21c1
Sequence:CCGGGGCAATGAGCACCTCTATGAGCTCGAGCTCATAGAGGTGCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024872.1-1547s21c1
Sequence:CCGGTGGGCTGGTGGGCAAACATTGCTCGAGCAATGTTTGCCCACCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-209s21c1
Sequence:CCGGACCAGCAGCATGTCAAGTTTGCTCGAGCAAACTTGACATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1280s21c1
Sequence:CCGGCAACCAGTCCCATCTACCACACTCGAGTGTGGTAGATGGGACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024872
DOK3 MISSION shRNA Lentiviral Transduction Particles
docking protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-213s1c1
Sequence:CCGGGCAGCATGTCAAGTTTGGCAACTCGAGTTGCCAAACTTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-216s1c1
Sequence:CCGGGCATGTCAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024872.1-1179s1c1
Sequence:CCGGCAATGAGCACCTCTATGAGAACTCGAGTTCTCATAGAGGTGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1404s21c1
Sequence:CCGGTGACCCTCAGGCAGGTTTCAACTCGAGTTGAAACCTGCCTGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1177s21c1
Sequence:CCGGGGCAATGAGCACCTCTATGAGCTCGAGCTCATAGAGGTGCTCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024872.1-1547s21c1
Sequence:CCGGTGGGCTGGTGGGCAAACATTGCTCGAGCAATGTTTGCCCACCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-209s21c1
Sequence:CCGGACCAGCAGCATGTCAAGTTTGCTCGAGCAAACTTGACATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024872.1-1280s21c1
Sequence:CCGGCAACCAGTCCCATCTACCACACTCGAGTGTGGTAGATGGGACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013739
DOK3 MISSION shRNA Bacterial Glycerol Stock
docking protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013739.1-1406s1c1
Sequence:CCGGCCAGGAACAACTTCGAACATACTCGAGTATGTTCGAAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-69s1c1
Sequence:CCGGGCAGCACGTAAAGTTTGGCAACTCGAGTTGCCAAACTTTACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-664s1c1
Sequence:CCGGGACAAGGGTGTGTTCTCGTTTCTCGAGAAACGAGAACACACCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-1145s1c1
Sequence:CCGGGCAGCCCTATCTACCATAACACTCGAGTGTTATGGTAGATAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-401s1c1
Sequence:CCGGCCGGAGAATGTTCGTCAGGATCTCGAGATCCTGACGAACATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-239s21c1
Sequence:CCGGTACGCTTGGCTGACTGTGTATCTCGAGATACACAGTCAGCCAAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-587s21c1
Sequence:CCGGACATCCAACTGAGGGAGACATCTCGAGATGTCTCCCTCAGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-495s21c1
Sequence:CCGGAGTGACCGAGTTTCCGGTGATCTCGAGATCACCGGAAACTCGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-636s21c1
Sequence:CCGGCTACCGTTTCCTGCGCAAGTACTCGAGTACTTGCGCAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-1048s21c1
Sequence:CCGGCTCTATGAGAACGTGTGCATGCTCGAGCATGCACACGTTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013739
DOK3 MISSION shRNA shRNA Plasmid DNA
docking protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013739.1-1406s1c1
Sequence:CCGGCCAGGAACAACTTCGAACATACTCGAGTATGTTCGAAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-69s1c1
Sequence:CCGGGCAGCACGTAAAGTTTGGCAACTCGAGTTGCCAAACTTTACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-664s1c1
Sequence:CCGGGACAAGGGTGTGTTCTCGTTTCTCGAGAAACGAGAACACACCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-1145s1c1
Sequence:CCGGGCAGCCCTATCTACCATAACACTCGAGTGTTATGGTAGATAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-401s1c1
Sequence:CCGGCCGGAGAATGTTCGTCAGGATCTCGAGATCCTGACGAACATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-239s21c1
Sequence:CCGGTACGCTTGGCTGACTGTGTATCTCGAGATACACAGTCAGCCAAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-587s21c1
Sequence:CCGGACATCCAACTGAGGGAGACATCTCGAGATGTCTCCCTCAGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-495s21c1
Sequence:CCGGAGTGACCGAGTTTCCGGTGATCTCGAGATCACCGGAAACTCGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-636s21c1
Sequence:CCGGCTACCGTTTCCTGCGCAAGTACTCGAGTACTTGCGCAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-1048s21c1
Sequence:CCGGCTCTATGAGAACGTGTGCATGCTCGAGCATGCACACGTTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013739
DOK3 MISSION shRNA Lentiviral Transduction Particles
docking protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013739.1-1406s1c1
Sequence:CCGGCCAGGAACAACTTCGAACATACTCGAGTATGTTCGAAGTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-69s1c1
Sequence:CCGGGCAGCACGTAAAGTTTGGCAACTCGAGTTGCCAAACTTTACGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-664s1c1
Sequence:CCGGGACAAGGGTGTGTTCTCGTTTCTCGAGAAACGAGAACACACCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-1145s1c1
Sequence:CCGGGCAGCCCTATCTACCATAACACTCGAGTGTTATGGTAGATAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013739.1-401s1c1
Sequence:CCGGCCGGAGAATGTTCGTCAGGATCTCGAGATCCTGACGAACATTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-239s21c1
Sequence:CCGGTACGCTTGGCTGACTGTGTATCTCGAGATACACAGTCAGCCAAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-587s21c1
Sequence:CCGGACATCCAACTGAGGGAGACATCTCGAGATGTCTCCCTCAGTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-495s21c1
Sequence:CCGGAGTGACCGAGTTTCCGGTGATCTCGAGATCACCGGAAACTCGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-636s21c1
Sequence:CCGGCTACCGTTTCCTGCGCAAGTACTCGAGTACTTGCGCAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013739.2-1048s21c1
Sequence:CCGGCTCTATGAGAACGTGTGCATGCTCGAGCATGCACACGTTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks