EMAIL THIS PAGE TO A FRIEND

DOK4

docking protein 4

108 Gene Product Result for
UniProtKB ID: Q8TEW6, O75209, Q9BTP2, Q9NVV3
Gene ID:
Mouse(114255) docking protein 4
Rat(361364) docking protein 4
Zebrafish(449759) docking protein 4
domestic cat(101085765) docking protein 4
Horse(100052258) docking protein 4
dog(487264) docking protein 4
chicken(430610) docking protein 4
sheep(101102081) docking protein 4
naked mole-rat(101726238) docking protein 4
domestic guinea pig(100722824) docking protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052431 MISSION® esiRNA esiRNA human DOK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018110 Rosetta Predictions human pricing
NM_001108438 Rosetta Predictions rat pricing
NM_053246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045509 predicted 689
2 SASI_Hs01_00045510 predicted 1042
3 SASI_Hs01_00045511 predicted 1513
4 SASI_Hs01_00045512 predicted 1570
5 SASI_Hs02_00351305 predicted 294
6 SASI_Hs01_00045513 predicted 842
7 SASI_Hs01_00045514 predicted 1090
8 SASI_Hs01_00045515 predicted 866
9 SASI_Hs01_00045516 predicted 558
10 SASI_Hs01_00045517 predicted 1024
11 SASI_Hs01_00045518 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238639 predicted 1044
2 SASI_Rn02_00238640 predicted 467
3 SASI_Rn02_00238641 predicted 875
4 SASI_Rn02_00238642 predicted 1102
5 SASI_Rn02_00238643 predicted 675
6 SASI_Rn02_00238644 predicted 1094
7 SASI_Rn02_00238645 predicted 1141
8 SASI_Rn02_00238646 predicted 1209
9 SASI_Rn02_00238647 predicted 293
10 SASI_Rn02_00238648 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337847 predicted 1181
2 SASI_Mm01_00035685 predicted 610
3 SASI_Mm01_00035686 predicted 684
4 SASI_Mm01_00035687 predicted 626
5 SASI_Mm01_00035688 predicted 458
6 SASI_Mm02_00337848 predicted 306
7 SASI_Mm01_00035691 predicted 852
8 SASI_Mm01_00035692 predicted 1495
9 SASI_Mm01_00035694 predicted 519
10 SASI_Mm02_00337849 predicted 286
11 SASI_Mm01_00035689 predicted 1192
12 SASI_Mm01_00035690 predicted 673
13 SASI_Mm01_00035693 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018110
VALIDATED
DOK4 MISSION shRNA Bacterial Glycerol Stock
docking protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-755s21c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-521s21c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-836s21c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-1259s21c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-463s1c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-778s1c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018110.2-1201s1c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-697s1c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018110
VALIDATED
DOK4 MISSION shRNA shRNA Plasmid DNA
docking protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-755s21c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-521s21c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-836s21c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-1259s21c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-463s1c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-778s1c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018110.2-1201s1c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-697s1c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018110
VALIDATED
DOK4 MISSION shRNA Lentiviral Transduction Particles
docking protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-755s21c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-521s21c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-836s21c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018110.3-1259s21c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-463s1c1
Sequence:CCGGCAAGGTGACTGAGATCAGCAACTCGAGTTGCTGATCTCAGTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-778s1c1
Sequence:CCGGGAACATCTACCTCTGGGACATCTCGAGATGTCCCAGAGGTAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018110.2-1201s1c1
Sequence:CCGGCAACAGATTCATCCTGCTAAACTCGAGTTTAGCAGGATGAATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018110.2-697s1c1
Sequence:CCGGGACAGATCGCTTCAATGTCTTCTCGAGAAGACATTGAAGCGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053246
VALIDATED
DOK4 MISSION shRNA Bacterial Glycerol Stock
docking protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-775s21c1
Sequence:CCGGACATCTACCTCTGGGACATACCTCGAGGTATGTCCCAGAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-2123s21c1
Sequence:CCGGCCCTGCTGAAATGCAATTAAACTCGAGTTTAATTGCATTTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-339s21c1
Sequence:CCGGAGCAGGAAGCTCGGGATTTACCTCGAGGTAAATCCCGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1108s21c1
Sequence:CCGGTCACAGGTTCTCAGAACATTGCTCGAGCAATGTTCTGAGAACCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1193s21c1
Sequence:CCGGGAACAGGTTCATCTTGCTTAACTCGAGTTAAGCAAGATGAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-1198s1c1
Sequence:CCGGGTTCATCTTGCTTAAGCCAAACTCGAGTTTGGCTTAAGCAAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-528s1c1
Sequence:CCGGCCATCATATTCACAGACGACTCTCGAGAGTCGTCTGTGAATATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053246
VALIDATED
DOK4 MISSION shRNA shRNA Plasmid DNA
docking protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-775s21c1
Sequence:CCGGACATCTACCTCTGGGACATACCTCGAGGTATGTCCCAGAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-2123s21c1
Sequence:CCGGCCCTGCTGAAATGCAATTAAACTCGAGTTTAATTGCATTTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-339s21c1
Sequence:CCGGAGCAGGAAGCTCGGGATTTACCTCGAGGTAAATCCCGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1108s21c1
Sequence:CCGGTCACAGGTTCTCAGAACATTGCTCGAGCAATGTTCTGAGAACCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1193s21c1
Sequence:CCGGGAACAGGTTCATCTTGCTTAACTCGAGTTAAGCAAGATGAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-1198s1c1
Sequence:CCGGGTTCATCTTGCTTAAGCCAAACTCGAGTTTGGCTTAAGCAAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-528s1c1
Sequence:CCGGCCATCATATTCACAGACGACTCTCGAGAGTCGTCTGTGAATATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053246
VALIDATED
DOK4 MISSION shRNA Lentiviral Transduction Particles
docking protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-775s21c1
Sequence:CCGGACATCTACCTCTGGGACATACCTCGAGGTATGTCCCAGAGGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-2123s21c1
Sequence:CCGGCCCTGCTGAAATGCAATTAAACTCGAGTTTAATTGCATTTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-339s21c1
Sequence:CCGGAGCAGGAAGCTCGGGATTTACCTCGAGGTAAATCCCGAGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1108s21c1
Sequence:CCGGTCACAGGTTCTCAGAACATTGCTCGAGCAATGTTCTGAGAACCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053246.2-1193s21c1
Sequence:CCGGGAACAGGTTCATCTTGCTTAACTCGAGTTAAGCAAGATGAACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-1198s1c1
Sequence:CCGGGTTCATCTTGCTTAAGCCAAACTCGAGTTTGGCTTAAGCAAGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053246.1-528s1c1
Sequence:CCGGCCATCATATTCACAGACGACTCTCGAGAGTCGTCTGTGAATATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks