EMAIL THIS PAGE TO A FRIEND

DOK5

docking protein 5

92 Gene Product Result for
Synonyms: C20orf180
Gene ID:
Human(55816) Summary: The protein encoded by this gene is a member of the DOK family of membrane proteins, which are adapter proteins involved in signal transduction. The encoded protein interacts with phosphorylated receptor tyrosine kinases to mediate neurite outgrowth and activation of the MAP kinase pathway. In contrast to other DOK family proteins, this protein does not interact with RASGAP. [provided by RefSeq, Jul 2008]
Mouse(76829) docking protein 5
Rat(502694) docking protein 5
domestic guinea pig(100727745) docking protein 5
naked mole-rat(101714431) docking protein 5
chicken(419336) docking protein 5
cow(530813) docking protein 5
domestic cat(101095407) docking protein 5
dog(485936) docking protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101865 Anti-DOK5 (266-278) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1101866 Anti-DOK5 (291-305) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300418 Anti-DOK5 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1300895 Anti-DOK5 (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA pricing
SAB1300894 Anti-DOK5 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2500324 Anti-DOK5 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2100612 Anti-DOK5 antibody produced in rabbit affinity isolated antibody pig, bovine, mouse, guinea pig, horse, rat, rabbit, human
western blot pricing
HPA065235 Anti-DOK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA054460 Anti-DOK5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018431 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018431 Rosetta Predictions human pricing
NM_001109344 Rosetta Predictions rat pricing
NM_029761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026952 predicted 782
2 SASI_Hs01_00026953 predicted 462
3 SASI_Hs01_00026954 predicted 675
4 SASI_Hs01_00026955 predicted 500
5 SASI_Hs01_00026956 predicted 686
6 SASI_Hs01_00026957 predicted 737
7 SASI_Hs01_00026958 predicted 312
8 SASI_Hs01_00026959 predicted 373
9 SASI_Hs01_00026960 predicted 651
10 SASI_Hs02_00351958 predicted 632
11 SASI_Hs01_00026951 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247504 predicted 204
2 SASI_Rn02_00247505 predicted 536
3 SASI_Rn02_00247506 predicted 303
4 SASI_Rn02_00247507 predicted 679
5 SASI_Rn02_00247508 predicted 530
6 SASI_Rn02_00247509 predicted 630
7 SASI_Rn02_00247510 predicted 479
8 SASI_Rn02_00247511 predicted 718
9 SASI_Rn02_00247512 predicted 777
10 SASI_Rn02_00247513 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110448 predicted 634
2 SASI_Mm01_00110449 predicted 700
3 SASI_Mm01_00110450 predicted 412
4 SASI_Mm01_00110451 predicted 834
5 SASI_Mm01_00110452 predicted 319
6 SASI_Mm01_00110453 predicted 451
7 SASI_Mm01_00110454 predicted 466
8 SASI_Mm01_00110455 predicted 247
9 SASI_Mm01_00110456 predicted 492
10 SASI_Mm01_00110457 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018431
DOK5 MISSION shRNA Bacterial Glycerol Stock
docking protein 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-844s1c1
Sequence:CCGGGTTTATCTTTCAGACCCGAGACTCGAGTCTCGGGTCTGAAAGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-503s1c1
Sequence:CCGGGAATCAGATCTTGAGGCTGATCTCGAGATCAGCCTCAAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-1088s1c1
Sequence:CCGGCCTCTGAAGCTTCATCGAACACTCGAGTGTTCGATGAAGCTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-536s1c1
Sequence:CCGGGTACTCCAGATGGAGTGTGTACTCGAGTACACACTCCATCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-730s1c1
Sequence:CCGGGAATCCCAGAGTCAAACTCATCTCGAGATGAGTTTGACTCTGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-652s1c1
Sequence:CCGGGCCATCTCCTAACTTAGATGTCTCGAGACATCTAAGTTAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-295s1c1
Sequence:CCGGGCGATGCTGGTTAGTATTCAACTCGAGTTGAATACTAACCAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-643s1c1
Sequence:CCGGGTATTTGATGCCATCTCCTAACTCGAGTTAGGAGATGGCATCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-451s21c1
Sequence:CCGGACATGCCATAGGGATTTATTTCTCGAGAAATAAATCCCTATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-358s21c1
Sequence:CCGGTGATGAACGTGCTGCATATTTCTCGAGAAATATGCAGCACGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-678s21c1
Sequence:CCGGGCGAATGTGCCTTGCAGATTACTCGAGTAATCTGCAAGGCACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018431.3-1245s21c1
Sequence:CCGGGCTTAAAGTCCTGGCTAATTGCTCGAGCAATTAGCCAGGACTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018431
DOK5 MISSION shRNA shRNA Plasmid DNA
docking protein 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-844s1c1
Sequence:CCGGGTTTATCTTTCAGACCCGAGACTCGAGTCTCGGGTCTGAAAGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-503s1c1
Sequence:CCGGGAATCAGATCTTGAGGCTGATCTCGAGATCAGCCTCAAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-1088s1c1
Sequence:CCGGCCTCTGAAGCTTCATCGAACACTCGAGTGTTCGATGAAGCTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-536s1c1
Sequence:CCGGGTACTCCAGATGGAGTGTGTACTCGAGTACACACTCCATCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-730s1c1
Sequence:CCGGGAATCCCAGAGTCAAACTCATCTCGAGATGAGTTTGACTCTGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-652s1c1
Sequence:CCGGGCCATCTCCTAACTTAGATGTCTCGAGACATCTAAGTTAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-295s1c1
Sequence:CCGGGCGATGCTGGTTAGTATTCAACTCGAGTTGAATACTAACCAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-643s1c1
Sequence:CCGGGTATTTGATGCCATCTCCTAACTCGAGTTAGGAGATGGCATCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-451s21c1
Sequence:CCGGACATGCCATAGGGATTTATTTCTCGAGAAATAAATCCCTATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-358s21c1
Sequence:CCGGTGATGAACGTGCTGCATATTTCTCGAGAAATATGCAGCACGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-678s21c1
Sequence:CCGGGCGAATGTGCCTTGCAGATTACTCGAGTAATCTGCAAGGCACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018431.3-1245s21c1
Sequence:CCGGGCTTAAAGTCCTGGCTAATTGCTCGAGCAATTAGCCAGGACTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018431
DOK5 MISSION shRNA Lentiviral Transduction Particles
docking protein 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-844s1c1
Sequence:CCGGGTTTATCTTTCAGACCCGAGACTCGAGTCTCGGGTCTGAAAGATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-503s1c1
Sequence:CCGGGAATCAGATCTTGAGGCTGATCTCGAGATCAGCCTCAAGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-1088s1c1
Sequence:CCGGCCTCTGAAGCTTCATCGAACACTCGAGTGTTCGATGAAGCTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-536s1c1
Sequence:CCGGGTACTCCAGATGGAGTGTGTACTCGAGTACACACTCCATCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-730s1c1
Sequence:CCGGGAATCCCAGAGTCAAACTCATCTCGAGATGAGTTTGACTCTGGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-652s1c1
Sequence:CCGGGCCATCTCCTAACTTAGATGTCTCGAGACATCTAAGTTAGGAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018431.2-295s1c1
Sequence:CCGGGCGATGCTGGTTAGTATTCAACTCGAGTTGAATACTAACCAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018431.2-643s1c1
Sequence:CCGGGTATTTGATGCCATCTCCTAACTCGAGTTAGGAGATGGCATCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-451s21c1
Sequence:CCGGACATGCCATAGGGATTTATTTCTCGAGAAATAAATCCCTATGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-358s21c1
Sequence:CCGGTGATGAACGTGCTGCATATTTCTCGAGAAATATGCAGCACGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018431.3-678s21c1
Sequence:CCGGGCGAATGTGCCTTGCAGATTACTCGAGTAATCTGCAAGGCACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018431.3-1245s21c1
Sequence:CCGGGCTTAAAGTCCTGGCTAATTGCTCGAGCAATTAGCCAGGACTTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029761
DOK5 MISSION shRNA Bacterial Glycerol Stock
docking protein 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-352s1c1
Sequence:CCGGCCACAAGGTTACAGAACTCAACTCGAGTTGAGTTCTGTAACCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-482s1c1
Sequence:CCGGGCAGACGAATGGTGCAAAGTTCTCGAGAACTTTGCACCATTCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-655s1c1
Sequence:CCGGGCAGATTACATATGAGTACATCTCGAGATGTACTCATATGTAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-617s1c1
Sequence:CCGGCCATCTCCTAACTTAGATGTACTCGAGTACATCTAAGTTAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-368s21c1
Sequence:CCGGAGCAGACGCCTAGGGATTTATCTCGAGATAAATCCCTAGGCGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-822s21c1
Sequence:CCGGTCCAGAATCCCAGAGTTAAACCTCGAGGTTTAACTCTGGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-676s21c1
Sequence:CCGGCCTCGGAGAGCCTGATTTATTCTCGAGAATAAATCAGGCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029761
DOK5 MISSION shRNA shRNA Plasmid DNA
docking protein 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-352s1c1
Sequence:CCGGCCACAAGGTTACAGAACTCAACTCGAGTTGAGTTCTGTAACCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-482s1c1
Sequence:CCGGGCAGACGAATGGTGCAAAGTTCTCGAGAACTTTGCACCATTCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-655s1c1
Sequence:CCGGGCAGATTACATATGAGTACATCTCGAGATGTACTCATATGTAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-617s1c1
Sequence:CCGGCCATCTCCTAACTTAGATGTACTCGAGTACATCTAAGTTAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-368s21c1
Sequence:CCGGAGCAGACGCCTAGGGATTTATCTCGAGATAAATCCCTAGGCGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-822s21c1
Sequence:CCGGTCCAGAATCCCAGAGTTAAACCTCGAGGTTTAACTCTGGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-676s21c1
Sequence:CCGGCCTCGGAGAGCCTGATTTATTCTCGAGAATAAATCAGGCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029761
DOK5 MISSION shRNA Lentiviral Transduction Particles
docking protein 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-352s1c1
Sequence:CCGGCCACAAGGTTACAGAACTCAACTCGAGTTGAGTTCTGTAACCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-482s1c1
Sequence:CCGGGCAGACGAATGGTGCAAAGTTCTCGAGAACTTTGCACCATTCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-655s1c1
Sequence:CCGGGCAGATTACATATGAGTACATCTCGAGATGTACTCATATGTAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029761.2-617s1c1
Sequence:CCGGCCATCTCCTAACTTAGATGTACTCGAGTACATCTAAGTTAGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-368s21c1
Sequence:CCGGAGCAGACGCCTAGGGATTTATCTCGAGATAAATCCCTAGGCGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-822s21c1
Sequence:CCGGTCCAGAATCCCAGAGTTAAACCTCGAGGTTTAACTCTGGGATTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029761.4-676s21c1
Sequence:CCGGCCTCGGAGAGCCTGATTTATTCTCGAGAATAAATCAGGCTCTCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks