EMAIL THIS PAGE TO A FRIEND

DOK6

docking protein 6

109 Gene Product Result for
Synonyms: DOK5L HsT3226
UniProtKB ID: Q6PKX4, A6NNG3, Q4V9S3, Q8WUZ8, Q96HI2, Q96LU2
Gene ID:
Human(220164) Summary: DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]
Mouse(623279) docking protein 6
Rat(498898) docking protein 6
Zebrafish(795289) docking protein 6
domestic cat(101097764) docking protein 6
cow(100336967) docking protein 6-like
Horse(100051970) docking protein 6
dog(476173) docking protein 6
chicken(421025) docking protein 6
sheep(101112783) docking protein 6
domestic guinea pig(100713631) docking protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152721 Rosetta Predictions human pricing
XM_001063746 Rosetta Predictions rat pricing
XM_574185 Rosetta Predictions rat pricing
NM_001039173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057493 predicted 1262
2 SASI_Hs01_00057495 predicted 444
3 SASI_Hs01_00057496 predicted 951
4 SASI_Hs02_00366624 predicted 762
5 SASI_Hs01_00057497 predicted 592
6 SASI_Hs01_00057498 predicted 458
7 SASI_Hs01_00057499 predicted 1004
8 SASI_Hs01_00057500 predicted 931
9 SASI_Hs01_00057501 predicted 850
10 SASI_Hs01_00057502 predicted 205
11 SASI_Hs01_00057494 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308186 predicted 1004
2 SASI_Rn02_00308187 predicted 1599
3 SASI_Rn02_00308188 predicted 1370
4 SASI_Rn02_00308189 predicted 1086
5 SASI_Rn02_00308190 predicted 983
6 SASI_Rn02_00308191 predicted 762
7 SASI_Rn02_00308192 predicted 831
8 SASI_Rn02_00308193 predicted 1072
9 SASI_Rn02_00308194 predicted 1273
10 SASI_Rn02_00308195 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401573 predicted 1004
2 SASI_Rn02_00401574 predicted 1083
3 SASI_Rn02_00401575 predicted 979
4 SASI_Rn02_00401576 predicted 757
5 SASI_Rn02_00401577 predicted 828
6 SASI_Rn02_00401578 predicted 1068
7 SASI_Rn02_00401579 predicted 964
8 SASI_Rn02_00401580 predicted 923
9 SASI_Rn02_00401581 predicted 749
10 SASI_Rn02_00401582 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096995 predicted 567
2 SASI_Mm01_00096996 predicted 461
3 SASI_Mm01_00096997 predicted 240
4 SASI_Mm01_00096998 predicted 522
5 SASI_Mm01_00096999 predicted 551
6 SASI_Mm01_00097000 predicted 334
7 SASI_Mm01_00097001 predicted 408
8 SASI_Mm01_00097002 predicted 395
9 SASI_Mm01_00097003 predicted 444
10 SASI_Mm01_00097004 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152721
DOK6 MISSION shRNA Bacterial Glycerol Stock
docking protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152721.5-1668s21c1
Sequence:CCGGGACATCGTAGCTGCATATAAACTCGAGTTTATATGCAGCTACGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-851s21c1
Sequence:CCGGGATCTATCAGAAGGTTCATTCCTCGAGGAATGAACCTTCTGATAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-890s21c1
Sequence:CCGGTGAGCAACATGAAAGATTAATCTCGAGATTAATCTTTCATGTTGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-302s1c1
Sequence:CCGGGCGGGAACAGAATGAGAGATTCTCGAGAATCTCTCATTCTGTTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-736s1c1
Sequence:CCGGGCGTTGGTGAAATCTACAGTTCTCGAGAACTGTAGATTTCACCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-655s1c1
Sequence:CCGGGCTTGACTGAACCAATGACATCTCGAGATGTCATTGGTTCAGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-606s1c1
Sequence:CCGGCATGAAAGATTAGTGCTAGAACTCGAGTTCTAGCACTAATCTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-488s1c1
Sequence:CCGGCACGTTTGAGTCAGGAAGAATCTCGAGATTCTTCCTGACTCAAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-737s1c1
Sequence:CCGGCGTTGGTGAAATCTACAGTTTCTCGAGAAACTGTAGATTTCACCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152721
DOK6 MISSION shRNA shRNA Plasmid DNA
docking protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152721.5-1668s21c1
Sequence:CCGGGACATCGTAGCTGCATATAAACTCGAGTTTATATGCAGCTACGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-851s21c1
Sequence:CCGGGATCTATCAGAAGGTTCATTCCTCGAGGAATGAACCTTCTGATAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-890s21c1
Sequence:CCGGTGAGCAACATGAAAGATTAATCTCGAGATTAATCTTTCATGTTGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-302s1c1
Sequence:CCGGGCGGGAACAGAATGAGAGATTCTCGAGAATCTCTCATTCTGTTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-736s1c1
Sequence:CCGGGCGTTGGTGAAATCTACAGTTCTCGAGAACTGTAGATTTCACCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-655s1c1
Sequence:CCGGGCTTGACTGAACCAATGACATCTCGAGATGTCATTGGTTCAGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-606s1c1
Sequence:CCGGCATGAAAGATTAGTGCTAGAACTCGAGTTCTAGCACTAATCTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-488s1c1
Sequence:CCGGCACGTTTGAGTCAGGAAGAATCTCGAGATTCTTCCTGACTCAAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-737s1c1
Sequence:CCGGCGTTGGTGAAATCTACAGTTTCTCGAGAAACTGTAGATTTCACCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152721
DOK6 MISSION shRNA Lentiviral Transduction Particles
docking protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152721.5-1668s21c1
Sequence:CCGGGACATCGTAGCTGCATATAAACTCGAGTTTATATGCAGCTACGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-851s21c1
Sequence:CCGGGATCTATCAGAAGGTTCATTCCTCGAGGAATGAACCTTCTGATAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152721.5-890s21c1
Sequence:CCGGTGAGCAACATGAAAGATTAATCTCGAGATTAATCTTTCATGTTGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-302s1c1
Sequence:CCGGGCGGGAACAGAATGAGAGATTCTCGAGAATCTCTCATTCTGTTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-736s1c1
Sequence:CCGGGCGTTGGTGAAATCTACAGTTCTCGAGAACTGTAGATTTCACCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-655s1c1
Sequence:CCGGGCTTGACTGAACCAATGACATCTCGAGATGTCATTGGTTCAGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-606s1c1
Sequence:CCGGCATGAAAGATTAGTGCTAGAACTCGAGTTCTAGCACTAATCTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-488s1c1
Sequence:CCGGCACGTTTGAGTCAGGAAGAATCTCGAGATTCTTCCTGACTCAAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152721.1-737s1c1
Sequence:CCGGCGTTGGTGAAATCTACAGTTTCTCGAGAAACTGTAGATTTCACCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039173
DOK6 MISSION shRNA Bacterial Glycerol Stock
docking protein 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-52s21c1
Sequence:CCGGAGCAGGAAGCTAGGGATATTCCTCGAGGAATATCCCTAGCTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-797s21c1
Sequence:CCGGGTGCATACTGGCATCACATTACTCGAGTAATGTGATGCCAGTATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-435s21c1
Sequence:CCGGTACACCCAACCTGGATATTTACTCGAGTAAATATCCAGGTTGGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-250s21c1
Sequence:CCGGTTTCATGACGAAACGTCAAAGCTCGAGCTTTGACGTTTCGTCATGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039173
DOK6 MISSION shRNA shRNA Plasmid DNA
docking protein 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-52s21c1
Sequence:CCGGAGCAGGAAGCTAGGGATATTCCTCGAGGAATATCCCTAGCTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-797s21c1
Sequence:CCGGGTGCATACTGGCATCACATTACTCGAGTAATGTGATGCCAGTATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-435s21c1
Sequence:CCGGTACACCCAACCTGGATATTTACTCGAGTAAATATCCAGGTTGGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-250s21c1
Sequence:CCGGTTTCATGACGAAACGTCAAAGCTCGAGCTTTGACGTTTCGTCATGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039173
DOK6 MISSION shRNA Lentiviral Transduction Particles
docking protein 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-52s21c1
Sequence:CCGGAGCAGGAAGCTAGGGATATTCCTCGAGGAATATCCCTAGCTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-797s21c1
Sequence:CCGGGTGCATACTGGCATCACATTACTCGAGTAATGTGATGCCAGTATGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-435s21c1
Sequence:CCGGTACACCCAACCTGGATATTTACTCGAGTAAATATCCAGGTTGGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039173.1-250s21c1
Sequence:CCGGTTTCATGACGAAACGTCAAAGCTCGAGCTTTGACGTTTCGTCATGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)