EMAIL THIS PAGE TO A FRIEND

DOK7

docking protein 7

47 Gene Product Result for
Synonyms: C4orf25 CMS1B
Gene ID:
Human(285489) Summary: The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(231134) docking protein 7
Rat(305448) docking protein 7
domestic guinea pig(100717783) docking protein 7
naked mole-rat(101725139) docking protein 7
sheep(101121682) docking protein 7
Zebrafish(557881) docking protein 7
dog(488794) docking protein 7
cow(524590) docking protein 7
domestic cat(101087477) docking protein 7
chicken(422875) docking protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173660 Rosetta Predictions human pricing
NM_001130062 Rosetta Predictions rat pricing
NM_172708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135082 predicted 1298
2 SASI_Hs02_00368579 predicted 270
3 SASI_Hs01_00135083 predicted 480
4 SASI_Hs01_00135084 predicted 696
5 SASI_Hs01_00135085 predicted 556
6 SASI_Hs02_00368580 predicted 397
7 SASI_Hs01_00135086 predicted 1866
8 SASI_Hs01_00135087 predicted 1658
9 SASI_Hs01_00135088 predicted 1569
10 SASI_Hs01_00135089 predicted 1048
11 SASI_Hs01_00135090 predicted 1149
12 SASI_Hs01_00135091 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255299 predicted 437
2 SASI_Rn02_00255300 predicted 1884
3 SASI_Rn02_00255301 predicted 1741
4 SASI_Rn02_00255302 predicted 579
5 SASI_Rn02_00255303 predicted 1912
6 SASI_Rn02_00255304 predicted 1667
7 SASI_Rn02_00255305 predicted 1954
8 SASI_Rn02_00255306 predicted 1894
9 SASI_Rn02_00255307 predicted 256
10 SASI_Rn02_00255308 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080795 predicted 205
2 SASI_Mm02_00344477 predicted 342
3 SASI_Mm01_00080796 predicted 1538
4 SASI_Mm01_00080797 predicted 1740
5 SASI_Mm01_00080798 predicted 1974
6 SASI_Mm01_00080799 predicted 209
7 SASI_Mm01_00080800 predicted 2058
8 SASI_Mm01_00080802 predicted 1868
9 SASI_Mm01_00080803 predicted 1425
10 SASI_Mm02_00344478 predicted 1667
11 SASI_Mm01_00080801 predicted 1062
12 SASI_Mm01_00080804 predicted 1675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172708
DOK7 MISSION shRNA Bacterial Glycerol Stock
docking protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1670s1c1
Sequence:CCGGCCCAGATTGACATTGCAGCTACTCGAGTAGCTGCAATGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1551s1c1
Sequence:CCGGGATGCCCACGTATGTGAATATCTCGAGATATTCACATACGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1983s1c1
Sequence:CCGGCCATATCAGTTCATTCCAATACTCGAGTATTGGAATGAACTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172708.1-490s1c1
Sequence:CCGGGCTGGAGTCTTCTTCTTGTCACTCGAGTGACAAGAAGAAGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1976s1c1
Sequence:CCGGGCCCAGACCATATCAGTTCATCTCGAGATGAACTGATATGGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172708
DOK7 MISSION shRNA shRNA Plasmid DNA
docking protein 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1670s1c1
Sequence:CCGGCCCAGATTGACATTGCAGCTACTCGAGTAGCTGCAATGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1551s1c1
Sequence:CCGGGATGCCCACGTATGTGAATATCTCGAGATATTCACATACGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1983s1c1
Sequence:CCGGCCATATCAGTTCATTCCAATACTCGAGTATTGGAATGAACTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172708.1-490s1c1
Sequence:CCGGGCTGGAGTCTTCTTCTTGTCACTCGAGTGACAAGAAGAAGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1976s1c1
Sequence:CCGGGCCCAGACCATATCAGTTCATCTCGAGATGAACTGATATGGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172708
DOK7 MISSION shRNA Lentiviral Transduction Particles
docking protein 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1670s1c1
Sequence:CCGGCCCAGATTGACATTGCAGCTACTCGAGTAGCTGCAATGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172708.1-1551s1c1
Sequence:CCGGGATGCCCACGTATGTGAATATCTCGAGATATTCACATACGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1983s1c1
Sequence:CCGGCCATATCAGTTCATTCCAATACTCGAGTATTGGAATGAACTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172708.1-490s1c1
Sequence:CCGGGCTGGAGTCTTCTTCTTGTCACTCGAGTGACAAGAAGAAGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172708.1-1976s1c1
Sequence:CCGGGCCCAGACCATATCAGTTCATCTCGAGATGAACTGATATGGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173660
DOK7 MISSION shRNA Bacterial Glycerol Stock
docking protein 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-555s1c1
Sequence:CCGGCCAAGCGGATTCATCTTTGAACTCGAGTTCAAAGATGAATCCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-562s1c1
Sequence:CCGGGATTCATCTTTGAAGGCGGGACTCGAGTCCCGCCTTCAAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-558s21c1
Sequence:CCGGTGCCAAGCGGATTCATCTTTGCTCGAGCAAAGATGAATCCGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173660.3-2007s21c1
Sequence:CCGGGGCAGTCACACCACCTGTTAACTCGAGTTAACAGGTGGTGTGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-457s21c1
Sequence:CCGGTACCCTGCACCTCTGCAATGACTCGAGTCATTGCAGAGGTGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-196s21c1
Sequence:CCGGGGACAAGTCGGAGCGTATCAACTCGAGTTGATACGCTCCGACTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-1552s21c1
Sequence:CCGGCTGTGGAGGACTCAAGGTAAACTCGAGTTTACCTTGAGTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173660
DOK7 MISSION shRNA shRNA Plasmid DNA
docking protein 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-555s1c1
Sequence:CCGGCCAAGCGGATTCATCTTTGAACTCGAGTTCAAAGATGAATCCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-562s1c1
Sequence:CCGGGATTCATCTTTGAAGGCGGGACTCGAGTCCCGCCTTCAAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-558s21c1
Sequence:CCGGTGCCAAGCGGATTCATCTTTGCTCGAGCAAAGATGAATCCGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173660.3-2007s21c1
Sequence:CCGGGGCAGTCACACCACCTGTTAACTCGAGTTAACAGGTGGTGTGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-457s21c1
Sequence:CCGGTACCCTGCACCTCTGCAATGACTCGAGTCATTGCAGAGGTGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-196s21c1
Sequence:CCGGGGACAAGTCGGAGCGTATCAACTCGAGTTGATACGCTCCGACTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-1552s21c1
Sequence:CCGGCTGTGGAGGACTCAAGGTAAACTCGAGTTTACCTTGAGTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173660
DOK7 MISSION shRNA Lentiviral Transduction Particles
docking protein 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-555s1c1
Sequence:CCGGCCAAGCGGATTCATCTTTGAACTCGAGTTCAAAGATGAATCCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173660.2-562s1c1
Sequence:CCGGGATTCATCTTTGAAGGCGGGACTCGAGTCCCGCCTTCAAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-558s21c1
Sequence:CCGGTGCCAAGCGGATTCATCTTTGCTCGAGCAAAGATGAATCCGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173660.3-2007s21c1
Sequence:CCGGGGCAGTCACACCACCTGTTAACTCGAGTTAACAGGTGGTGTGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-457s21c1
Sequence:CCGGTACCCTGCACCTCTGCAATGACTCGAGTCATTGCAGAGGTGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-196s21c1
Sequence:CCGGGGACAAGTCGGAGCGTATCAACTCGAGTTGATACGCTCCGACTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173660.3-1552s21c1
Sequence:CCGGCTGTGGAGGACTCAAGGTAAACTCGAGTTTACCTTGAGTCCTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks