EMAIL THIS PAGE TO A FRIEND

DOLK

dolichol kinase

42 Gene Product Result for
Synonyms: CDG1M DK DK1 SEC59 TMEM15
UniProtKB ID: Q9UPQ8, Q5SRE6
Gene ID:
Human(22845) Summary: The protein encoded by this gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man, which is an essential glycosyl carrier lipid for C- and O-mannosylation, N- and O-linked glycosylation of proteins, and for the biosynthesis of glycosyl phosphatidylinositol anchors in endoplasmic reticulum. Mutations in this gene are associated with dolichol kinase deficiency.[provided by RefSeq, Apr 2010]
Mouse(227697) dolichol kinase
Rat(311847) dolichol kinase
Zebrafish(799960) dolichol kinase
cow(526844) dolichol kinase
domestic cat(101083720) dolichol kinase
dog(480701) dolichol kinase
chicken(417199) dolichol kinase
sheep(101116296) dolichol kinase
naked mole-rat(101711037) dolichol kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301194 ANTI-DOLK (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029061 MISSION® esiRNA esiRNA human DOLK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014908 Rosetta Predictions human pricing
NM_001107826 Rosetta Predictions rat pricing
NM_177648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032839 predicted 1435
2 SASI_Hs01_00032840 predicted 1515
3 SASI_Hs01_00032841 predicted 1924
4 SASI_Hs01_00032842 predicted 1450
5 SASI_Hs01_00032843 predicted 1201
6 SASI_Hs01_00032844 predicted 1631
7 SASI_Hs01_00032845 predicted 1886
8 SASI_Hs01_00032846 predicted 1502
9 SASI_Hs01_00032847 predicted 1863
10 SASI_Hs02_00346547 predicted 1463
11 SASI_Hs01_00032848 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232655 predicted 1602
2 SASI_Rn02_00232656 predicted 854
3 SASI_Rn02_00232657 predicted 837
4 SASI_Rn02_00232658 predicted 873
5 SASI_Rn02_00232659 predicted 1685
6 SASI_Rn02_00232660 predicted 1256
7 SASI_Rn02_00232661 predicted 772
8 SASI_Rn02_00232662 predicted 1804
9 SASI_Rn02_00232663 predicted 1815
10 SASI_Rn02_00232664 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347917 predicted 582
2 SASI_Mm02_00347918 predicted 897
3 SASI_Mm02_00347919 predicted 912
4 SASI_Mm02_00347920 predicted 911
5 SASI_Mm02_00347921 predicted 1193
6 SASI_Mm02_00347922 predicted 829
7 SASI_Mm02_00347923 predicted 1199
8 SASI_Mm02_00347924 predicted 1865
9 SASI_Mm02_00347925 predicted 1736
10 SASI_Mm02_00347926 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014908
VALIDATED
DOLK MISSION shRNA Bacterial Glycerol Stock
dolichol kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1439s21c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1917s21c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1150s21c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-689s21c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1437s1c1
Sequence:CCGGCCCGAAAGTATTTCCACCTCACTCGAGTGAGGTGGAAATACTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1439s1c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1861s1c1
Sequence:CCGGGACATCTATATTTGCGCAGATCTCGAGATCTGCGCAAATATAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-949s1c1
Sequence:CCGGCTTCGTTTATCTCAACATGATCTCGAGATCATGTTGAGATAAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-946s1c1
Sequence:CCGGGATCTTCGTTTATCTCAACATCTCGAGATGTTGAGATAAACGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1917s1c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-694s1c1
Sequence:CCGGGCCTTTGCTTGGACTAGTCATCTCGAGATGACTAGTCCAAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-689s1c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1150s1c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-2014s1c1
Sequence:CCGGGCCTCTCTACCTCCTGATATTCTCGAGAATATCAGGAGGTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-838s1c1
Sequence:CCGGGCCAACCAACACTTGTGTCATCTCGAGATGACACAAGTGTTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-1876s1c1
Sequence:CCGGGCAGATCATTTCTGTAGCTCTCTCGAGAGAGCTACAGAAATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014908
VALIDATED
DOLK MISSION shRNA shRNA Plasmid DNA
dolichol kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1439s21c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1917s21c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1150s21c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-689s21c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1437s1c1
Sequence:CCGGCCCGAAAGTATTTCCACCTCACTCGAGTGAGGTGGAAATACTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1439s1c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1861s1c1
Sequence:CCGGGACATCTATATTTGCGCAGATCTCGAGATCTGCGCAAATATAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-949s1c1
Sequence:CCGGCTTCGTTTATCTCAACATGATCTCGAGATCATGTTGAGATAAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-946s1c1
Sequence:CCGGGATCTTCGTTTATCTCAACATCTCGAGATGTTGAGATAAACGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1917s1c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-694s1c1
Sequence:CCGGGCCTTTGCTTGGACTAGTCATCTCGAGATGACTAGTCCAAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-689s1c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1150s1c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-2014s1c1
Sequence:CCGGGCCTCTCTACCTCCTGATATTCTCGAGAATATCAGGAGGTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-838s1c1
Sequence:CCGGGCCAACCAACACTTGTGTCATCTCGAGATGACACAAGTGTTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-1876s1c1
Sequence:CCGGGCAGATCATTTCTGTAGCTCTCTCGAGAGAGCTACAGAAATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014908
VALIDATED
DOLK MISSION shRNA Lentiviral Transduction Particles
dolichol kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1439s21c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1917s21c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-1150s21c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014908.3-689s21c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1437s1c1
Sequence:CCGGCCCGAAAGTATTTCCACCTCACTCGAGTGAGGTGGAAATACTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1439s1c1
Sequence:CCGGCGAAAGTATTTCCACCTCATTCTCGAGAATGAGGTGGAAATACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014908.3-1861s1c1
Sequence:CCGGGACATCTATATTTGCGCAGATCTCGAGATCTGCGCAAATATAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-949s1c1
Sequence:CCGGCTTCGTTTATCTCAACATGATCTCGAGATCATGTTGAGATAAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-946s1c1
Sequence:CCGGGATCTTCGTTTATCTCAACATCTCGAGATGTTGAGATAAACGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1917s1c1
Sequence:CCGGGAGTGGACCTAAACTACAGTTCTCGAGAACTGTAGTTTAGGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-694s1c1
Sequence:CCGGGCCTTTGCTTGGACTAGTCATCTCGAGATGACTAGTCCAAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-689s1c1
Sequence:CCGGGTCATGCCTTTGCTTGGACTACTCGAGTAGTCCAAGCAAAGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014908.3-1150s1c1
Sequence:CCGGCTTCAGCACTCTGTTTGTCTTCTCGAGAAGACAAACAGAGTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-2014s1c1
Sequence:CCGGGCCTCTCTACCTCCTGATATTCTCGAGAATATCAGGAGGTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014908.3-838s1c1
Sequence:CCGGGCCAACCAACACTTGTGTCATCTCGAGATGACACAAGTGTTGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014908.3-1876s1c1
Sequence:CCGGGCAGATCATTTCTGTAGCTCTCTCGAGAGAGCTACAGAAATGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177648
VALIDATED
DOLK MISSION shRNA Bacterial Glycerol Stock
dolichol kinase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177648.3-1336s21c1
Sequence:CCGGTCATTGTGGTAGCCACTTATACTCGAGTATAAGTGGCTACCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-915s21c1
Sequence:CCGGGGCATTAGCTTCGTCCTTAACCTCGAGGTTAAGGACGAAGCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1663s21c1
Sequence:CCGGATACTGTGGCCTCCATATTTGCTCGAGCAAATATGGAGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1436s21c1
Sequence:CCGGTGTGCGCTATTTCCGAATAAACTCGAGTTTATTCGGAAATAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1949s21c1
Sequence:CCGGGGGAAACAGGGAAATAGAATGCTCGAGCATTCTATTTCCCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177648.2-1062s1c1
Sequence:CCGGCATTGTGGTAGCCACTTATATCTCGAGATATAAGTGGCTACCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177648.2-1676s1c1
Sequence:CCGGGAAACAGGGAAATAGAATGAACTCGAGTTCATTCTATTTCCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177648
VALIDATED
DOLK MISSION shRNA shRNA Plasmid DNA
dolichol kinase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177648.3-1336s21c1
Sequence:CCGGTCATTGTGGTAGCCACTTATACTCGAGTATAAGTGGCTACCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-915s21c1
Sequence:CCGGGGCATTAGCTTCGTCCTTAACCTCGAGGTTAAGGACGAAGCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1663s21c1
Sequence:CCGGATACTGTGGCCTCCATATTTGCTCGAGCAAATATGGAGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1436s21c1
Sequence:CCGGTGTGCGCTATTTCCGAATAAACTCGAGTTTATTCGGAAATAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1949s21c1
Sequence:CCGGGGGAAACAGGGAAATAGAATGCTCGAGCATTCTATTTCCCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177648.2-1062s1c1
Sequence:CCGGCATTGTGGTAGCCACTTATATCTCGAGATATAAGTGGCTACCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177648.2-1676s1c1
Sequence:CCGGGAAACAGGGAAATAGAATGAACTCGAGTTCATTCTATTTCCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177648
VALIDATED
DOLK MISSION shRNA Lentiviral Transduction Particles
dolichol kinase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177648.3-1336s21c1
Sequence:CCGGTCATTGTGGTAGCCACTTATACTCGAGTATAAGTGGCTACCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-915s21c1
Sequence:CCGGGGCATTAGCTTCGTCCTTAACCTCGAGGTTAAGGACGAAGCTAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1663s21c1
Sequence:CCGGATACTGTGGCCTCCATATTTGCTCGAGCAAATATGGAGGCCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1436s21c1
Sequence:CCGGTGTGCGCTATTTCCGAATAAACTCGAGTTTATTCGGAAATAGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177648.3-1949s21c1
Sequence:CCGGGGGAAACAGGGAAATAGAATGCTCGAGCATTCTATTTCCCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177648.2-1062s1c1
Sequence:CCGGCATTGTGGTAGCCACTTATATCTCGAGATATAAGTGGCTACCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177648.2-1676s1c1
Sequence:CCGGGAAACAGGGAAATAGAATGAACTCGAGTTCATTCTATTTCCCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks