EMAIL THIS PAGE TO A FRIEND

DOLPP1

dolichyldiphosphatase 1

176 Gene Product Result for
Synonyms: LSFR2
UniProtKB ID: Q86YN1, A8K3U8, B0QZG4, Q96GF8, Q9Y3G1
Gene ID:
Human(57171) Summary: A similar gene has been characterized in mice and encodes dolichyl pyrophosphate (Dol-P-P) phosphatase. This protein dephosphorylates dolichyl pyrophosphate so that it may be re-utilized as a glycosyl carrier lipid by the oligosaccharyltransferase multisubunit complex in the ER. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Mouse(57170) dolichyl pyrophosphate phosphatase 1
Rat(296624) dolichyldiphosphatase 1
Zebrafish(474331) dolichyl pyrophosphate phosphatase 1
cow(504908) dolichyl pyrophosphate phosphatase 1
domestic cat(101084239) dolichyl pyrophosphate phosphatase 1
dog(612827) dolichyl pyrophosphate phosphatase 1
chicken(417196) dolichyl pyrophosphate phosphatase 1
domestic guinea pig(100719877) dolichyldiphosphatase 1
naked mole-rat(101708077) dolichyldiphosphatase 1
sheep(101105901) dolichyl pyrophosphate phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019179 Anti-DOLPP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV49511 Anti-DOLPP1 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, bovine, mouse, rat, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020438 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086031 MISSION® esiRNA esiRNA human DOLPP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020438 Rosetta Predictions human pricing
NM_001106567 Rosetta Predictions rat pricing
NM_020329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014914 predicted 1070
2 SASI_Hs01_00014915 predicted 1068
3 SASI_Hs01_00014916 predicted 596
4 SASI_Hs01_00014918 predicted 808
5 SASI_Hs01_00014919 predicted 137
6 SASI_Hs01_00014920 predicted 57
7 SASI_Hs01_00014921 predicted 131
8 SASI_Hs01_00014922 predicted 642
9 SASI_Hs01_00014917 predicted 1063
10 SASI_Hs02_00353460 predicted 944
11 SASI_Hs01_00014923 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220228 predicted 1132
2 SASI_Rn02_00220229 predicted 252
3 SASI_Rn02_00220230 predicted 401
4 SASI_Rn02_00220231 predicted 265
5 SASI_Rn02_00220232 predicted 680
6 SASI_Rn02_00220233 predicted 1133
7 SASI_Rn02_00220234 predicted 240
8 SASI_Rn02_00220235 predicted 1116
9 SASI_Rn02_00220236 predicted 1152
10 SASI_Rn02_00220237 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155941 predicted 1078
2 SASI_Mm01_00155942 predicted 547
3 SASI_Mm01_00155943 predicted 226
4 SASI_Mm01_00155944 predicted 478
5 SASI_Mm01_00155945 predicted 633
6 SASI_Mm01_00155946 predicted 1188
7 SASI_Mm01_00155948 predicted 392
8 SASI_Mm01_00155949 predicted 548
9 SASI_Mm01_00155950 predicted 274
10 SASI_Mm02_00325524 predicted 276
11 SASI_Mm01_00155947 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020329
DOLPP1 MISSION shRNA Bacterial Glycerol Stock
dolichyldiphosphatase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020329.1-1484s1c1
Sequence:CCGGCCAAGCGTTTACAGCTCCTTTCTCGAGAAAGGAGCTGTAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-459s1c1
Sequence:CCGGGCGGCCTTTCTCGTCTCCTATCTCGAGATAGGAGACGAGAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-560s1c1
Sequence:CCGGGTTCATCATCACGCAGGAAATCTCGAGATTTCCTGCGTGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-392s1c1
Sequence:CCGGCCAAACAAATAACGCCAGGTTCTCGAGAACCTGGCGTTATTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-666s1c1
Sequence:CCGGCTCTGGTTTGAGTACACAGTACTCGAGTACTGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-125s21c1
Sequence:CCGGACCTGAGCCTCAGCCCTATTTCTCGAGAAATAGGGCTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-233s21c1
Sequence:CCGGGCGTCAACTGGCTGATCAAACCTCGAGGTTTGATCAGCCAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-289s21c1
Sequence:CCGGCATACAGCAGTGGGCACTAAGCTCGAGCTTAGTGCCCACTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020329.3-1081s21c1
Sequence:CCGGTAGCGGAATGCGCACTATTTACTCGAGTAAATAGTGCGCATTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-361s21c1
Sequence:CCGGTCCTTCCTCTTCCTGTATTTACTCGAGTAAATACAGGAAGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020329
DOLPP1 MISSION shRNA shRNA Plasmid DNA
dolichyldiphosphatase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020329.1-1484s1c1
Sequence:CCGGCCAAGCGTTTACAGCTCCTTTCTCGAGAAAGGAGCTGTAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-459s1c1
Sequence:CCGGGCGGCCTTTCTCGTCTCCTATCTCGAGATAGGAGACGAGAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-560s1c1
Sequence:CCGGGTTCATCATCACGCAGGAAATCTCGAGATTTCCTGCGTGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-392s1c1
Sequence:CCGGCCAAACAAATAACGCCAGGTTCTCGAGAACCTGGCGTTATTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-666s1c1
Sequence:CCGGCTCTGGTTTGAGTACACAGTACTCGAGTACTGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-125s21c1
Sequence:CCGGACCTGAGCCTCAGCCCTATTTCTCGAGAAATAGGGCTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-233s21c1
Sequence:CCGGGCGTCAACTGGCTGATCAAACCTCGAGGTTTGATCAGCCAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-289s21c1
Sequence:CCGGCATACAGCAGTGGGCACTAAGCTCGAGCTTAGTGCCCACTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020329.3-1081s21c1
Sequence:CCGGTAGCGGAATGCGCACTATTTACTCGAGTAAATAGTGCGCATTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-361s21c1
Sequence:CCGGTCCTTCCTCTTCCTGTATTTACTCGAGTAAATACAGGAAGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020329
DOLPP1 MISSION shRNA Lentiviral Transduction Particles
dolichyldiphosphatase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020329.1-1484s1c1
Sequence:CCGGCCAAGCGTTTACAGCTCCTTTCTCGAGAAAGGAGCTGTAAACGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-459s1c1
Sequence:CCGGGCGGCCTTTCTCGTCTCCTATCTCGAGATAGGAGACGAGAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-560s1c1
Sequence:CCGGGTTCATCATCACGCAGGAAATCTCGAGATTTCCTGCGTGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-392s1c1
Sequence:CCGGCCAAACAAATAACGCCAGGTTCTCGAGAACCTGGCGTTATTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020329.1-666s1c1
Sequence:CCGGCTCTGGTTTGAGTACACAGTACTCGAGTACTGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-125s21c1
Sequence:CCGGACCTGAGCCTCAGCCCTATTTCTCGAGAAATAGGGCTGAGGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-233s21c1
Sequence:CCGGGCGTCAACTGGCTGATCAAACCTCGAGGTTTGATCAGCCAGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-289s21c1
Sequence:CCGGCATACAGCAGTGGGCACTAAGCTCGAGCTTAGTGCCCACTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020329.3-1081s21c1
Sequence:CCGGTAGCGGAATGCGCACTATTTACTCGAGTAAATAGTGCGCATTCCGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020329.3-361s21c1
Sequence:CCGGTCCTTCCTCTTCCTGTATTTACTCGAGTAAATACAGGAAGAGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020438
VALIDATED
DOLPP1 MISSION shRNA Bacterial Glycerol Stock
dolichyldiphosphatase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020438.2-337s1c1
Sequence:CCGGCCATTCCCAGTTTATGTGGTTCTCGAGAACCACATAAACTGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-172s1c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-636s1c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-149s1c1
Sequence:CCGGCCTGTATTTGTCATCGTCGGTCTCGAGACCGACGATGACAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-674s1c1
Sequence:CCGGCTCTGGTTTGAGTACACGGTACTCGAGTACCGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020438.4-824s21c1
Sequence:GTACCGGACGAAGCAGAGACCTCTACAGCTCGAGCTGTAGAGGTCTCTGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-169s21c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-633s21c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-77s21c1
Sequence:CCGGACCCTCACCCACGTCGAATATCTCGAGATATTCGACGTGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-382s21c1
Sequence:CCGGGTATTTAAGAATGCACCAAACCTCGAGGTTTGGTGCATTCTTAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-1096s21c1
Sequence:CCGGGTGAGAAGTACACACTATTTACTCGAGTAAATAGTGTGTACTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020438
VALIDATED
DOLPP1 MISSION shRNA shRNA Plasmid DNA
dolichyldiphosphatase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020438.2-337s1c1
Sequence:CCGGCCATTCCCAGTTTATGTGGTTCTCGAGAACCACATAAACTGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-172s1c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-636s1c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-149s1c1
Sequence:CCGGCCTGTATTTGTCATCGTCGGTCTCGAGACCGACGATGACAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-674s1c1
Sequence:CCGGCTCTGGTTTGAGTACACGGTACTCGAGTACCGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020438.4-824s21c1
Sequence:GTACCGGACGAAGCAGAGACCTCTACAGCTCGAGCTGTAGAGGTCTCTGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-169s21c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-633s21c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-77s21c1
Sequence:CCGGACCCTCACCCACGTCGAATATCTCGAGATATTCGACGTGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-382s21c1
Sequence:CCGGGTATTTAAGAATGCACCAAACCTCGAGGTTTGGTGCATTCTTAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-1096s21c1
Sequence:CCGGGTGAGAAGTACACACTATTTACTCGAGTAAATAGTGTGTACTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020438
VALIDATED
DOLPP1 MISSION shRNA Lentiviral Transduction Particles
dolichyldiphosphatase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020438.2-337s1c1
Sequence:CCGGCCATTCCCAGTTTATGTGGTTCTCGAGAACCACATAAACTGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-172s1c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-636s1c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-149s1c1
Sequence:CCGGCCTGTATTTGTCATCGTCGGTCTCGAGACCGACGATGACAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_020438.2-674s1c1
Sequence:CCGGCTCTGGTTTGAGTACACGGTACTCGAGTACCGTGTACTCAAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020438.4-824s21c1
Sequence:GTACCGGACGAAGCAGAGACCTCTACAGCTCGAGCTGTAGAGGTCTCTGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-169s21c1
Sequence:CCGGCGTGACCCTCATCATATTTAACTCGAGTTAAATATGATGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020438.4-633s21c1
Sequence:CCGGTCTTCCTAATCCGAGACACAACTCGAGTTGTGTCTCGGATTAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-77s21c1
Sequence:CCGGACCCTCACCCACGTCGAATATCTCGAGATATTCGACGTGGGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-382s21c1
Sequence:CCGGGTATTTAAGAATGCACCAAACCTCGAGGTTTGGTGCATTCTTAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020438.4-1096s21c1
Sequence:CCGGGTGAGAAGTACACACTATTTACTCGAGTAAATAGTGTGTACTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks