EMAIL THIS PAGE TO A FRIEND

DONSON

downstream neighbor of SON

64 Gene Product Result for
Synonyms: B17 C21orf60 C2TA
UniProtKB ID: Q9NYP3, Q8NC53, Q9NSR9, Q9NVZ5, Q9NYP1, Q9NYP2
Gene ID:
Human(29980) Summary: This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
Mouse(60364) downstream neighbor of SON
Rat(288257) downstream neighbor of SON
chicken(418504) downstream neighbor of SON
cow(522248) downstream neighbor of SON
Horse(100063043) downstream neighbor of SON
domestic cat(101089288) downstream neighbor of SON
dog(478407) downstream neighbor of SON
domestic guinea pig(100726345) downstream neighbor of SON
naked mole-rat(101696334) downstream neighbor of SON
sheep(101112786) downstream neighbor of SON
Domestic Rabbit(100328922) downstream neighbor of SON
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017613 Rosetta Predictions human pricing
NM_001008287 Rosetta Predictions rat pricing
NM_021720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179945 predicted 1252
2 SASI_Hs01_00179946 predicted 515
3 SASI_Hs01_00179948 predicted 761
4 SASI_Hs01_00179949 predicted 1275
5 SASI_Hs01_00179950 predicted 1705
6 SASI_Hs01_00179951 predicted 569
7 SASI_Hs01_00179952 predicted 1011
8 SASI_Hs01_00179953 predicted 1000
9 SASI_Hs02_00350284 predicted 1453
10 SASI_Hs01_00179954 predicted 796
11 SASI_Hs01_00179947 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088409 predicted 1627
2 SASI_Rn01_00088410 predicted 1323
3 SASI_Rn01_00088412 predicted 787
4 SASI_Rn01_00088413 predicted 1028
5 SASI_Rn01_00088414 predicted 1227
6 SASI_Rn02_00198988 predicted 934
7 SASI_Rn01_00088416 predicted 1544
8 SASI_Rn01_00088417 predicted 1651
9 SASI_Rn01_00088418 predicted 1297
10 SASI_Rn02_00198989 predicted 1440
11 SASI_Rn01_00088411 predicted 542
12 SASI_Rn01_00088415 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024422 predicted 950
2 SASI_Mm01_00024423 predicted 930
3 SASI_Mm01_00024424 predicted 451
4 SASI_Mm01_00024425 predicted 407
5 SASI_Mm01_00024426 predicted 1662
6 SASI_Mm01_00024427 predicted 945
7 SASI_Mm01_00024428 predicted 1415
8 SASI_Mm01_00024429 predicted 1448
9 SASI_Mm01_00024430 predicted 1389
10 SASI_Mm01_00024431 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145794
VALIDATED
DONSON MISSION shRNA Bacterial Glycerol Stock
downstream neighbor of SON
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145794.1-1016s1c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145794.1-527s1c1
Sequence:CCGGCCTGTGGACTGGAGTATTAAACTCGAGTTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-1397s1c1
Sequence:CCGGCGAGCCAACTGCTGTATTTAACTCGAGTTAAATACAGCAGTTGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-458s1c1
Sequence:CCGGGAATTACCTCAGACTTCACATCTCGAGATGTGAAGTCTGAGGTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145794.1-765s1c1
Sequence:CCGGCTCGTATTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAATACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145794
VALIDATED
DONSON MISSION shRNA shRNA Plasmid DNA
downstream neighbor of SON
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145794.1-1016s1c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145794.1-527s1c1
Sequence:CCGGCCTGTGGACTGGAGTATTAAACTCGAGTTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-1397s1c1
Sequence:CCGGCGAGCCAACTGCTGTATTTAACTCGAGTTAAATACAGCAGTTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-458s1c1
Sequence:CCGGGAATTACCTCAGACTTCACATCTCGAGATGTGAAGTCTGAGGTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145794.1-765s1c1
Sequence:CCGGCTCGTATTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAATACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145794
VALIDATED
DONSON MISSION shRNA Lentiviral Transduction Particles
downstream neighbor of SON
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145794.1-1016s1c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145794.1-527s1c1
Sequence:CCGGCCTGTGGACTGGAGTATTAAACTCGAGTTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-1397s1c1
Sequence:CCGGCGAGCCAACTGCTGTATTTAACTCGAGTTAAATACAGCAGTTGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_145794.1-458s1c1
Sequence:CCGGGAATTACCTCAGACTTCACATCTCGAGATGTGAAGTCTGAGGTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145794.1-765s1c1
Sequence:CCGGCTCGTATTGGAGCTGATAGAACTCGAGTTCTATCAGCTCCAATACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021720
DONSON MISSION shRNA Bacterial Glycerol Stock
downstream neighbor of SON
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-1927s1c1
Sequence:CCGGGCTTCCTTAATACCTCAGATACTCGAGTATCTGAGGTATTAAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-2148s1c1
Sequence:CCGGGCTCTCACGTATGTTCATCTTCTCGAGAAGATGAACATACGTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-824s21c1
Sequence:CCGGACAAAGCTTTGTCCCTATTTCCTCGAGGAAATAGGGACAAAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021720.1-950s1c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1099s21c1
Sequence:CCGGGATAGGCGTGCAAGATCAAATCTCGAGATTTGATCTTGCACGCCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-2027s21c1
Sequence:CCGGGACTACCTGTAGCAATTATTCCTCGAGGAATAATTGCTACAGGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1383s21c1
Sequence:CCGGCTGGATACAGAGATAAGTTTACTCGAGTAAACTTATCTCTGTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-950s21c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-460s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1569s21c1
Sequence:CCGGCTCGTGAGGACCTTGCTAATTCTCGAGAATTAGCAAGGTCCTCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-1959s21c1
Sequence:CCGGAGTTCTATCCCTGCAACTTATCTCGAGATAAGTTGCAGGGATAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021720
DONSON MISSION shRNA shRNA Plasmid DNA
downstream neighbor of SON
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-1927s1c1
Sequence:CCGGGCTTCCTTAATACCTCAGATACTCGAGTATCTGAGGTATTAAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-2148s1c1
Sequence:CCGGGCTCTCACGTATGTTCATCTTCTCGAGAAGATGAACATACGTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-824s21c1
Sequence:CCGGACAAAGCTTTGTCCCTATTTCCTCGAGGAAATAGGGACAAAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021720.1-950s1c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1099s21c1
Sequence:CCGGGATAGGCGTGCAAGATCAAATCTCGAGATTTGATCTTGCACGCCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-2027s21c1
Sequence:CCGGGACTACCTGTAGCAATTATTCCTCGAGGAATAATTGCTACAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1383s21c1
Sequence:CCGGCTGGATACAGAGATAAGTTTACTCGAGTAAACTTATCTCTGTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-950s21c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-460s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1569s21c1
Sequence:CCGGCTCGTGAGGACCTTGCTAATTCTCGAGAATTAGCAAGGTCCTCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-1959s21c1
Sequence:CCGGAGTTCTATCCCTGCAACTTATCTCGAGATAAGTTGCAGGGATAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021720
DONSON MISSION shRNA Lentiviral Transduction Particles
downstream neighbor of SON
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-1927s1c1
Sequence:CCGGGCTTCCTTAATACCTCAGATACTCGAGTATCTGAGGTATTAAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021720.1-2148s1c1
Sequence:CCGGGCTCTCACGTATGTTCATCTTCTCGAGAAGATGAACATACGTGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-824s21c1
Sequence:CCGGACAAAGCTTTGTCCCTATTTCCTCGAGGAAATAGGGACAAAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021720.1-950s1c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1099s21c1
Sequence:CCGGGATAGGCGTGCAAGATCAAATCTCGAGATTTGATCTTGCACGCCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-2027s21c1
Sequence:CCGGGACTACCTGTAGCAATTATTCCTCGAGGAATAATTGCTACAGGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1383s21c1
Sequence:CCGGCTGGATACAGAGATAAGTTTACTCGAGTAAACTTATCTCTGTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-950s21c1
Sequence:CCGGGCTATGAGAAACGAAGGTATTCTCGAGAATACCTTCGTTTCTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-460s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021720.1-1569s21c1
Sequence:CCGGCTCGTGAGGACCTTGCTAATTCTCGAGAATTAGCAAGGTCCTCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021720.1-1959s21c1
Sequence:CCGGAGTTCTATCCCTGCAACTTATCTCGAGATAAGTTGCAGGGATAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017613
VALIDATED
DONSON MISSION shRNA Bacterial Glycerol Stock
downstream neighbor of SON
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-483s21c1
Sequence:CCGGCATTCTCCGAGCCTGATATTCCTCGAGGAATATCAGGCTCGGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-577s21c1
Sequence:CCGGCTTTACCTGGGCAGATCATTTCTCGAGAAATGATCTGCCCAGGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-1195s21c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-2003s21c1
Sequence:CCGGTTGAGCAGAAACTGAATTAATCTCGAGATTAATTCAGTTTCTGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-526s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017613
VALIDATED
DONSON MISSION shRNA shRNA Plasmid DNA
downstream neighbor of SON
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-483s21c1
Sequence:CCGGCATTCTCCGAGCCTGATATTCCTCGAGGAATATCAGGCTCGGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-577s21c1
Sequence:CCGGCTTTACCTGGGCAGATCATTTCTCGAGAAATGATCTGCCCAGGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-1195s21c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-2003s21c1
Sequence:CCGGTTGAGCAGAAACTGAATTAATCTCGAGATTAATTCAGTTTCTGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-526s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017613
VALIDATED
DONSON MISSION shRNA Lentiviral Transduction Particles
downstream neighbor of SON
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-483s21c1
Sequence:CCGGCATTCTCCGAGCCTGATATTCCTCGAGGAATATCAGGCTCGGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-577s21c1
Sequence:CCGGCTTTACCTGGGCAGATCATTTCTCGAGAAATGATCTGCCCAGGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-1195s21c1
Sequence:CCGGGCCAGACATACTTTCTATCAACTCGAGTTGATAGAAAGTATGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017613.2-2003s21c1
Sequence:CCGGTTGAGCAGAAACTGAATTAATCTCGAGATTAATTCAGTTTCTGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017613.2-526s21c1
Sequence:CCGGACCTGTGGACTGGAGTATTAACTCGAGTTAATACTCCAGTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)