EMAIL THIS PAGE TO A FRIEND

DOPEY1

dopey family member 1

233 Gene Product Result for
Synonyms: KIAA1117 dJ202D23.2
UniProtKB ID: Q5JWR5, Q86XV1, Q9H5J5, Q9NSL4, Q9UPN5, Q9Y414
Gene ID:
Mouse(320615) dopey family member 1
Rat(315864) dopey family member 1
Zebrafish(448893) dopey family member 1
cow(541096) dopey family member 1
Horse(100065361) dopey family member 1
domestic cat(101081383) dopey family member 1
dog(474980) dopey family member 1
chicken(421842) dopey family member 1
sheep(101114709) dopey family member 1
naked mole-rat(101718965) dopey family member 1
domestic guinea pig(100729469) dopey family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015018 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015018 Rosetta Predictions human pricing
XM_001062758 Rosetta Predictions rat pricing
XM_236449 Rosetta Predictions rat pricing
NM_177208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040947 predicted 3377
2 SASI_Hs01_00040948 predicted 850
3 SASI_Hs01_00040949 predicted 1092
4 SASI_Hs01_00040950 predicted 1287
5 SASI_Hs01_00040951 predicted 6696
6 SASI_Hs01_00040952 predicted 2558
7 SASI_Hs01_00040953 predicted 6647
8 SASI_Hs01_00040955 predicted 4628
9 SASI_Hs02_00346802 predicted 3719
10 SASI_Hs02_00346803 predicted 4651
11 SASI_Hs01_00040954 predicted 6666
12 SASI_Hs01_00040956 predicted 7251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304473 predicted 1023
2 SASI_Rn02_00304474 predicted 6130
3 SASI_Rn02_00304475 predicted 3530
4 SASI_Rn02_00304476 predicted 3065
5 SASI_Rn02_00304477 predicted 1993
6 SASI_Rn02_00304478 predicted 974
7 SASI_Rn02_00304479 predicted 6247
8 SASI_Rn02_00304480 predicted 5926
9 SASI_Rn02_00304481 predicted 3060
10 SASI_Rn02_00304482 predicted 5835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390059 predicted 1020
2 SASI_Rn02_00390060 predicted 6137
3 SASI_Rn02_00390061 predicted 3529
4 SASI_Rn02_00390062 predicted 3066
5 SASI_Rn02_00390063 predicted 1993
6 SASI_Rn02_00390064 predicted 971
7 SASI_Rn02_00390065 predicted 6254
8 SASI_Rn02_00390066 predicted 5926
9 SASI_Rn02_00390067 predicted 3058
10 SASI_Rn02_00390068 predicted 5839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347223 predicted 6680
2 SASI_Mm02_00347224 predicted 3797
3 SASI_Mm02_00347225 predicted 3124
4 SASI_Mm02_00347226 predicted 2542
5 SASI_Mm02_00347227 predicted 1359
6 SASI_Mm02_00347228 predicted 3451
7 SASI_Mm02_00347229 predicted 1837
8 SASI_Mm02_00347230 predicted 4786
9 SASI_Mm02_00347231 predicted 6203
10 SASI_Mm02_00347232 predicted 4832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015018
DOPEY1 MISSION shRNA Bacterial Glycerol Stock
dopey family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3702s21c1
Sequence:CCGGGATGTTCAACAGGTAGTATTTCTCGAGAAATACTACCTGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-7090s21c1
Sequence:CCGGCAACGTACACAGGAGGTAATGCTCGAGCATTACCTCCTGTGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-1538s21c1
Sequence:CCGGTAATTCCTTCGAACCTTATTACTCGAGTAATAAGGTTCGAAGGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7713s21c1
Sequence:CCGGCACACTGCTCTGCGTTGTATACTCGAGTATACAACGCAGAGCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7660s21c1
Sequence:CCGGCACCATTGCTGGTTCCATTTACTCGAGTAAATGGAACCAGCAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3466s21c1
Sequence:CCGGGTCTCACTGTGAATCCATTAACTCGAGTTAATGGATTCACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5639s1c1
Sequence:CCGGCGCATCTCTTACCACTATTAACTCGAGTTAATAGTGGTAAGAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-873s1c1
Sequence:CCGGGCCCATTTAAACAGGAAGCTTCTCGAGAAGCTTCCTGTTTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-6236s1c1
Sequence:CCGGGCGACGAAATCTTGAAGTTAACTCGAGTTAACTTCAAGATTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-3394s1c1
Sequence:CCGGGCCAAGTACAACTCATCACATCTCGAGATGTGATGAGTTGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5228s1c1
Sequence:CCGGGCACCCACAATGGATTGGTTTCTCGAGAAACCAATCCATTGTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015018
DOPEY1 MISSION shRNA shRNA Plasmid DNA
dopey family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3702s21c1
Sequence:CCGGGATGTTCAACAGGTAGTATTTCTCGAGAAATACTACCTGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-7090s21c1
Sequence:CCGGCAACGTACACAGGAGGTAATGCTCGAGCATTACCTCCTGTGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-1538s21c1
Sequence:CCGGTAATTCCTTCGAACCTTATTACTCGAGTAATAAGGTTCGAAGGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7713s21c1
Sequence:CCGGCACACTGCTCTGCGTTGTATACTCGAGTATACAACGCAGAGCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7660s21c1
Sequence:CCGGCACCATTGCTGGTTCCATTTACTCGAGTAAATGGAACCAGCAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3466s21c1
Sequence:CCGGGTCTCACTGTGAATCCATTAACTCGAGTTAATGGATTCACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5639s1c1
Sequence:CCGGCGCATCTCTTACCACTATTAACTCGAGTTAATAGTGGTAAGAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-873s1c1
Sequence:CCGGGCCCATTTAAACAGGAAGCTTCTCGAGAAGCTTCCTGTTTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-6236s1c1
Sequence:CCGGGCGACGAAATCTTGAAGTTAACTCGAGTTAACTTCAAGATTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-3394s1c1
Sequence:CCGGGCCAAGTACAACTCATCACATCTCGAGATGTGATGAGTTGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5228s1c1
Sequence:CCGGGCACCCACAATGGATTGGTTTCTCGAGAAACCAATCCATTGTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015018
DOPEY1 MISSION shRNA Lentiviral Transduction Particles
dopey family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3702s21c1
Sequence:CCGGGATGTTCAACAGGTAGTATTTCTCGAGAAATACTACCTGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-7090s21c1
Sequence:CCGGCAACGTACACAGGAGGTAATGCTCGAGCATTACCTCCTGTGTACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-1538s21c1
Sequence:CCGGTAATTCCTTCGAACCTTATTACTCGAGTAATAAGGTTCGAAGGAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7713s21c1
Sequence:CCGGCACACTGCTCTGCGTTGTATACTCGAGTATACAACGCAGAGCAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015018.2-7660s21c1
Sequence:CCGGCACCATTGCTGGTTCCATTTACTCGAGTAAATGGAACCAGCAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015018.2-3466s21c1
Sequence:CCGGGTCTCACTGTGAATCCATTAACTCGAGTTAATGGATTCACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5639s1c1
Sequence:CCGGCGCATCTCTTACCACTATTAACTCGAGTTAATAGTGGTAAGAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-873s1c1
Sequence:CCGGGCCCATTTAAACAGGAAGCTTCTCGAGAAGCTTCCTGTTTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-6236s1c1
Sequence:CCGGGCGACGAAATCTTGAAGTTAACTCGAGTTAACTTCAAGATTTCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-3394s1c1
Sequence:CCGGGCCAAGTACAACTCATCACATCTCGAGATGTGATGAGTTGTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015018.2-5228s1c1
Sequence:CCGGGCACCCACAATGGATTGGTTTCTCGAGAAACCAATCCATTGTGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks