EMAIL THIS PAGE TO A FRIEND

DOPEY2

dopey family member 2

75 Gene Product Result for
Synonyms: 21orf5 C21orf5
UniProtKB ID: Q9Y3R5, D3DSG5, Q6PJQ7, Q9UEZ3
Gene ID:
Mouse(70028) dopey family member 2
Rat(304077) dopey family member 2
domestic guinea pig(100726811) dopey family member 2
naked mole-rat(101717502) dopey family member 2
sheep(101115672) dopey family member 2
Zebrafish(393582) dopey family member 2
cow(514520) dopey family member 2
domestic cat(101082590) dopey family member 2
dog(487749) dopey family member 2
chicken(100858524) dopey family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA072065 Anti-DOPEY2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005128 Rosetta Predictions human pricing
XM_001055500 Rosetta Predictions rat pricing
XM_221640 Rosetta Predictions rat pricing
NM_026700 Rosetta Predictions mouse pricing
NM_027293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076299 predicted 6564
2 SASI_Hs01_00076300 predicted 1781
3 SASI_Hs01_00076302 predicted 970
4 SASI_Hs02_00339044 predicted 6500
5 SASI_Hs01_00076304 predicted 388
6 SASI_Hs01_00076305 predicted 2360
7 SASI_Hs01_00076307 predicted 6222
8 SASI_Hs02_00339045 predicted 6821
9 SASI_Hs02_00339046 predicted 5344
10 SASI_Hs01_00076308 predicted 4048
11 SASI_Hs01_00076301 predicted 788
12 SASI_Hs01_00076303 predicted 2908
13 SASI_Hs01_00076306 predicted 4989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279731 predicted 1425
2 SASI_Rn02_00279732 predicted 1160
3 SASI_Rn02_00279733 predicted 232
4 SASI_Rn02_00279734 predicted 5139
5 SASI_Rn02_00279735 predicted 6983
6 SASI_Rn02_00279736 predicted 6321
7 SASI_Rn02_00279737 predicted 3415
8 SASI_Rn02_00279738 predicted 2046
9 SASI_Rn02_00279739 predicted 6900
10 SASI_Rn02_00279740 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380251 predicted 1258
2 SASI_Rn02_00380252 predicted 993
3 SASI_Rn02_00380253 predicted 4995
4 SASI_Rn02_00380254 predicted 6833
5 SASI_Rn02_00380255 predicted 6186
6 SASI_Rn02_00380256 predicted 3272
7 SASI_Rn02_00380257 predicted 2791
8 SASI_Rn02_00380258 predicted 1881
9 SASI_Rn02_00380259 predicted 6752
10 SASI_Rn02_00380260 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036244 predicted 380
2 SASI_Mm01_00036245 predicted 322
3 SASI_Mm01_00036246 predicted 270
4 SASI_Mm01_00036247 predicted 205
5 SASI_Mm01_00036249 predicted 429
6 SASI_Mm01_00036250 predicted 439
7 SASI_Mm01_00036251 predicted 225
8 SASI_Mm01_00036252 predicted 430
9 SASI_Mm02_00330742 predicted 204
10 SASI_Mm01_00036253 predicted 231
11 SASI_Mm01_00036248 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087678 predicted 382
2 SASI_Mm01_00087679 predicted 322
3 SASI_Mm01_00087680 predicted 274
4 SASI_Mm01_00087681 predicted 200
5 SASI_Mm01_00087683 predicted 430
6 SASI_Mm01_00087684 predicted 443
7 SASI_Mm01_00087685 predicted 227
8 SASI_Mm01_00087686 predicted 433
9 SASI_Mm02_00331898 predicted 208
10 SASI_Mm01_00087687 predicted 231
11 SASI_Mm01_00087682 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005128
DOPEY2 MISSION shRNA Bacterial Glycerol Stock
dopey family member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-2657s1c1
Sequence:CCGGCCAGGGATATTGAAAGTCATTCTCGAGAATGACTTTCAATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-5859s1c1
Sequence:CCGGCCCGTCTGCTTTACTATGTTTCTCGAGAAACATAGTAAAGCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-126s1c1
Sequence:CCGGGCTACTCTTCAGTGATTGAAACTCGAGTTTCAATCACTGAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005128.2-7438s1c1
Sequence:CCGGCCTCCCTAAATGCCTTGTAATCTCGAGATTACAAGGCATTTAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-3158s1c1
Sequence:CCGGCGTTGGTTTAACAGGAAGAAACTCGAGTTTCTTCCTGTTAAACCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-1308s21c1
Sequence:CCGGAGAGTGGAAATTCGCTGATAACTCGAGTTATCAGCGAATTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-6044s21c1
Sequence:CCGGGTTCATTGGAAGTCCATTATTCTCGAGAATAATGGACTTCCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-2576s21c1
Sequence:CCGGGACAAGATGAAACGCTATAAGCTCGAGCTTATAGCGTTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005128
DOPEY2 MISSION shRNA shRNA Plasmid DNA
dopey family member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-2657s1c1
Sequence:CCGGCCAGGGATATTGAAAGTCATTCTCGAGAATGACTTTCAATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-5859s1c1
Sequence:CCGGCCCGTCTGCTTTACTATGTTTCTCGAGAAACATAGTAAAGCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-126s1c1
Sequence:CCGGGCTACTCTTCAGTGATTGAAACTCGAGTTTCAATCACTGAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005128.2-7438s1c1
Sequence:CCGGCCTCCCTAAATGCCTTGTAATCTCGAGATTACAAGGCATTTAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-3158s1c1
Sequence:CCGGCGTTGGTTTAACAGGAAGAAACTCGAGTTTCTTCCTGTTAAACCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-1308s21c1
Sequence:CCGGAGAGTGGAAATTCGCTGATAACTCGAGTTATCAGCGAATTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-6044s21c1
Sequence:CCGGGTTCATTGGAAGTCCATTATTCTCGAGAATAATGGACTTCCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-2576s21c1
Sequence:CCGGGACAAGATGAAACGCTATAAGCTCGAGCTTATAGCGTTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005128
DOPEY2 MISSION shRNA Lentiviral Transduction Particles
dopey family member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-2657s1c1
Sequence:CCGGCCAGGGATATTGAAAGTCATTCTCGAGAATGACTTTCAATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-5859s1c1
Sequence:CCGGCCCGTCTGCTTTACTATGTTTCTCGAGAAACATAGTAAAGCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-126s1c1
Sequence:CCGGGCTACTCTTCAGTGATTGAAACTCGAGTTTCAATCACTGAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005128.2-7438s1c1
Sequence:CCGGCCTCCCTAAATGCCTTGTAATCTCGAGATTACAAGGCATTTAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005128.2-3158s1c1
Sequence:CCGGCGTTGGTTTAACAGGAAGAAACTCGAGTTTCTTCCTGTTAAACCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-1308s21c1
Sequence:CCGGAGAGTGGAAATTCGCTGATAACTCGAGTTATCAGCGAATTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-6044s21c1
Sequence:CCGGGTTCATTGGAAGTCCATTATTCTCGAGAATAATGGACTTCCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005128.2-2576s21c1
Sequence:CCGGGACAAGATGAAACGCTATAAGCTCGAGCTTATAGCGTTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026700
DOPEY2 MISSION shRNA Bacterial Glycerol Stock
dopey family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-436s1c1
Sequence:CCGGCCTAGAAACCTACGAGATCATCTCGAGATGATCTCGTAGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-217s1c1
Sequence:CCGGCGATTACAGATACAGAAGCTACTCGAGTAGCTTCTGTATCTGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-241s1c1
Sequence:CCGGCTCAGTAATCGAGAAGGCGTTCTCGAGAACGCCTTCTCGATTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-341s1c1
Sequence:CCGGCTGAAGTATTCCCTCCTACCACTCGAGTGGTAGGAGGGAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-445s1c1
Sequence:CCGGCTACGAGATCATCTTCAAGATCTCGAGATCTTGAAGATGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026700
DOPEY2 MISSION shRNA shRNA Plasmid DNA
dopey family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-436s1c1
Sequence:CCGGCCTAGAAACCTACGAGATCATCTCGAGATGATCTCGTAGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-217s1c1
Sequence:CCGGCGATTACAGATACAGAAGCTACTCGAGTAGCTTCTGTATCTGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-241s1c1
Sequence:CCGGCTCAGTAATCGAGAAGGCGTTCTCGAGAACGCCTTCTCGATTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-341s1c1
Sequence:CCGGCTGAAGTATTCCCTCCTACCACTCGAGTGGTAGGAGGGAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-445s1c1
Sequence:CCGGCTACGAGATCATCTTCAAGATCTCGAGATCTTGAAGATGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026700
DOPEY2 MISSION shRNA Lentiviral Transduction Particles
dopey family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-436s1c1
Sequence:CCGGCCTAGAAACCTACGAGATCATCTCGAGATGATCTCGTAGGTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-217s1c1
Sequence:CCGGCGATTACAGATACAGAAGCTACTCGAGTAGCTTCTGTATCTGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-241s1c1
Sequence:CCGGCTCAGTAATCGAGAAGGCGTTCTCGAGAACGCCTTCTCGATTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-341s1c1
Sequence:CCGGCTGAAGTATTCCCTCCTACCACTCGAGTGGTAGGAGGGAATACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026700.2-445s1c1
Sequence:CCGGCTACGAGATCATCTTCAAGATCTCGAGATCTTGAAGATGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks