EMAIL THIS PAGE TO A FRIEND

DOT1L

DOT1-like histone H3K79 methyltransferase

82 Gene Product Result for
Synonyms: DOT1 KMT4
UniProtKB ID: Q8TEK3, O60379, Q96JL1
Gene ID:
Human(84444) Summary: The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
Mouse(208266) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
Rat(362831) DOT1-like histone H3K79 methyltransferase
Zebrafish(559945) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
domestic cat(101101194) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
cow(510442) DOT1-like histone H3K79 methyltransferase
Horse(100068506) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
dog(485073) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
chicken(420078) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
domestic guinea pig(100713595) DOT1-like histone H3K79 methyltransferase
naked mole-rat(101712712) DOT1-like histone H3K79 methyltransferase
sheep(101121261) DOT1-like, histone H3 methyltransferase (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092391 MISSION® esiRNA esiRNA human DOT1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032482 Rosetta Predictions human pricing
NM_001108733 Rosetta Predictions rat pricing
NM_199322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161195 predicted 961
2 SASI_Hs01_00161197 predicted 973
3 SASI_Hs01_00161198 predicted 2500
4 SASI_Hs02_00359932 predicted 688
5 SASI_Hs01_00161199 predicted 1690
6 SASI_Hs01_00161200 predicted 591
7 SASI_Hs01_00161201 predicted 1708
8 SASI_Hs01_00161202 predicted 669
9 SASI_Hs02_00359933 predicted 763
10 SASI_Hs01_00161203 predicted 326
11 SASI_Hs01_00161196 predicted 4031
12 SASI_Hs01_00161204 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241545 predicted 864
2 SASI_Rn02_00241546 predicted 2628
3 SASI_Rn02_00241547 predicted 974
4 SASI_Rn02_00241548 predicted 1194
5 SASI_Rn02_00241549 predicted 4243
6 SASI_Rn02_00241550 predicted 797
7 SASI_Rn02_00241551 predicted 4338
8 SASI_Rn02_00241552 predicted 1932
9 SASI_Rn02_00241553 predicted 396
10 SASI_Rn02_00241554 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036557 predicted 1182
2 SASI_Mm01_00036558 predicted 1165
3 SASI_Mm01_00036559 predicted 896
4 SASI_Mm01_00036560 predicted 937
5 SASI_Mm01_00036561 predicted 1065
6 SASI_Mm01_00036563 predicted 763
7 SASI_Mm01_00036564 predicted 3733
8 SASI_Mm01_00036565 predicted 3373
9 SASI_Mm02_00351458 predicted 2754
10 SASI_Mm01_00036566 predicted 1906
11 SASI_Mm01_00036562 predicted 4317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032482
VALIDATED
DOT1L MISSION shRNA Bacterial Glycerol Stock
DOT1-like histone H3K79 methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-1216s21c1
Sequence:CCGGGCCCGCAAGAAGAAGCTAAACCTCGAGGTTTAGCTTCTTCTTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032482.2-5370s21c1
Sequence:CCGGCACGTTGAACAAGTGCATTTACTCGAGTAAATGCACTTGTTCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-731s21c1
Sequence:CCGGTCGCCAACACGAGTGTTATATCTCGAGATATAACACTCGTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032482.2-578s21c1
Sequence:CCGGATCACTATGGCGTCGAGAAAGCTCGAGCTTTCTCGACGCCATAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-684s21c1
Sequence:CCGGCACATTGGAGAGAGGCGATTTCTCGAGAAATCGCCTCTCTCCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-732s1c1
Sequence:CCGGCGCCAACACGAGTGTTATATTCTCGAGAATATAACACTCGTGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-1218s1c1
Sequence:CCGGCCGCAAGAAGAAGCTAAACAACTCGAGTTGTTTAGCTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-3623s1c1
Sequence:CCGGGCAGTGCTCGAATTGAGAGAACTCGAGTTCTCTCAATTCGAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032482.1-1957s1c1
Sequence:CCGGCAGATCAGCATTGTGGAGCTACTCGAGTAGCTCCACAATGCTGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-180s1c1
Sequence:CCGGCCCGGATCTCAAGCTCGCTATCTCGAGATAGCGAGCTTGAGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032482
VALIDATED
DOT1L MISSION shRNA shRNA Plasmid DNA
DOT1-like histone H3K79 methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-1216s21c1
Sequence:CCGGGCCCGCAAGAAGAAGCTAAACCTCGAGGTTTAGCTTCTTCTTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032482.2-5370s21c1
Sequence:CCGGCACGTTGAACAAGTGCATTTACTCGAGTAAATGCACTTGTTCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-731s21c1
Sequence:CCGGTCGCCAACACGAGTGTTATATCTCGAGATATAACACTCGTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032482.2-578s21c1
Sequence:CCGGATCACTATGGCGTCGAGAAAGCTCGAGCTTTCTCGACGCCATAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-684s21c1
Sequence:CCGGCACATTGGAGAGAGGCGATTTCTCGAGAAATCGCCTCTCTCCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-732s1c1
Sequence:CCGGCGCCAACACGAGTGTTATATTCTCGAGAATATAACACTCGTGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-1218s1c1
Sequence:CCGGCCGCAAGAAGAAGCTAAACAACTCGAGTTGTTTAGCTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-3623s1c1
Sequence:CCGGGCAGTGCTCGAATTGAGAGAACTCGAGTTCTCTCAATTCGAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032482.1-1957s1c1
Sequence:CCGGCAGATCAGCATTGTGGAGCTACTCGAGTAGCTCCACAATGCTGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-180s1c1
Sequence:CCGGCCCGGATCTCAAGCTCGCTATCTCGAGATAGCGAGCTTGAGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032482
VALIDATED
DOT1L MISSION shRNA Lentiviral Transduction Particles
DOT1-like histone H3K79 methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-1216s21c1
Sequence:CCGGGCCCGCAAGAAGAAGCTAAACCTCGAGGTTTAGCTTCTTCTTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032482.2-5370s21c1
Sequence:CCGGCACGTTGAACAAGTGCATTTACTCGAGTAAATGCACTTGTTCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-731s21c1
Sequence:CCGGTCGCCAACACGAGTGTTATATCTCGAGATATAACACTCGTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032482.2-578s21c1
Sequence:CCGGATCACTATGGCGTCGAGAAAGCTCGAGCTTTCTCGACGCCATAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_032482.2-684s21c1
Sequence:CCGGCACATTGGAGAGAGGCGATTTCTCGAGAAATCGCCTCTCTCCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-732s1c1
Sequence:CCGGCGCCAACACGAGTGTTATATTCTCGAGAATATAACACTCGTGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-1218s1c1
Sequence:CCGGCCGCAAGAAGAAGCTAAACAACTCGAGTTGTTTAGCTTCTTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-3623s1c1
Sequence:CCGGGCAGTGCTCGAATTGAGAGAACTCGAGTTCTCTCAATTCGAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032482.1-1957s1c1
Sequence:CCGGCAGATCAGCATTGTGGAGCTACTCGAGTAGCTCCACAATGCTGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032482.1-180s1c1
Sequence:CCGGCCCGGATCTCAAGCTCGCTATCTCGAGATAGCGAGCTTGAGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199322
VALIDATED
DOT1L MISSION shRNA Bacterial Glycerol Stock
DOT1-like histone H3K79 methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4987s1c1
Sequence:CCGGGTCCAGTTTGTACTGTCAATACTCGAGTATTGACAGTACAAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199322.1-610s1c1
Sequence:CCGGGCTTAACAACTACGAGCCCTTCTCGAGAAGGGCTCGTAGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1027s1c1
Sequence:CCGGCGGCAGAATCGTATCCTCAAACTCGAGTTTGAGGATACGATTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1906s1c1
Sequence:CCGGGCTGACCTACAATGACCTGATCTCGAGATCAGGTCATTGTAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4216s1c1
Sequence:CCGGCCTCGGTTTACACAGCTTCAACTCGAGTTGAAGCTGTGTAAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199322
VALIDATED
DOT1L MISSION shRNA shRNA Plasmid DNA
DOT1-like histone H3K79 methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4987s1c1
Sequence:CCGGGTCCAGTTTGTACTGTCAATACTCGAGTATTGACAGTACAAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199322.1-610s1c1
Sequence:CCGGGCTTAACAACTACGAGCCCTTCTCGAGAAGGGCTCGTAGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1027s1c1
Sequence:CCGGCGGCAGAATCGTATCCTCAAACTCGAGTTTGAGGATACGATTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1906s1c1
Sequence:CCGGGCTGACCTACAATGACCTGATCTCGAGATCAGGTCATTGTAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4216s1c1
Sequence:CCGGCCTCGGTTTACACAGCTTCAACTCGAGTTGAAGCTGTGTAAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199322
VALIDATED
DOT1L MISSION shRNA Lentiviral Transduction Particles
DOT1-like histone H3K79 methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4987s1c1
Sequence:CCGGGTCCAGTTTGTACTGTCAATACTCGAGTATTGACAGTACAAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199322.1-610s1c1
Sequence:CCGGGCTTAACAACTACGAGCCCTTCTCGAGAAGGGCTCGTAGTTGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1027s1c1
Sequence:CCGGCGGCAGAATCGTATCCTCAAACTCGAGTTTGAGGATACGATTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-1906s1c1
Sequence:CCGGGCTGACCTACAATGACCTGATCTCGAGATCAGGTCATTGTAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199322.1-4216s1c1
Sequence:CCGGCCTCGGTTTACACAGCTTCAACTCGAGTTGAAGCTGTGTAAACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks