EMAIL THIS PAGE TO A FRIEND

DPAGT1

dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)

141 Gene Product Result for
Synonyms: ALG7 CDG-Ij CDG1J CMSTA2 D11S366 DGPT DPAGT DPAGT2 G1PT GPT UAGT UGAT
UniProtKB ID: Q9H3H5, O15216, Q86WV9, Q9BWE6
Gene ID:
Human(1798) Summary: The protein encoded by this gene is an enzyme that catalyzes the first step in the dolichol-linked oligosaccharide pathway for glycoprotein biosynthesis. This enzyme belongs to the glycosyltransferase family 4. This protein is an integral membrane protein of the endoplasmic reticulum. The congenital disorder of glycosylation type Ij is caused by mutation in the gene encoding this enzyme. [provided by RefSeq, Jul 2008]
Mouse(13478) dolichyl-phosphate (UDP-N-acetylglucosamine) acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Rat(300668) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
sheep(101107219) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
domestic guinea pig(100720260) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
naked mole-rat(101702241) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Zebrafish(566539) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
chicken(419699) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
dog(489371) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
cow(537812) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
domestic cat(101095368) dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001382 Rosetta Predictions human pricing
NM_203316 Rosetta Predictions human pricing
NM_199388 Rosetta Predictions rat pricing
NM_007875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043903 predicted 1600
2 SASI_Hs02_00331736 predicted 593
3 SASI_Hs02_00331737 predicted 710
4 SASI_Hs02_00331738 predicted 785
5 SASI_Hs01_00043901 predicted 1502
6 SASI_Hs02_00331739 predicted 1478
7 SASI_Hs01_00043904 predicted 1606
8 SASI_Hs02_00331740 predicted 1388
9 SASI_Hs02_00331741 predicted 586
10 SASI_Hs02_00331742 predicted 1650
11 SASI_Hs01_00043899 predicted 1434
12 SASI_Hs01_00043900 predicted 1830
13 SASI_Hs01_00043902 predicted 1652
14 SASI_Hs01_00043905 predicted 1696
15 SASI_Hs01_00043906 predicted 1641
16 SASI_Hs01_00043907 predicted 1357
17 SASI_Hs01_00043908 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081376 predicted 1313
2 SASI_Hs01_00081377 predicted 1709
3 SASI_Hs01_00081378 predicted 1387
4 SASI_Hs01_00081379 predicted 1534
5 SASI_Hs01_00081380 predicted 1483
6 SASI_Hs01_00081381 predicted 1491
7 SASI_Hs01_00081382 predicted 1575
8 SASI_Hs01_00081383 predicted 1524
9 SASI_Hs01_00081384 predicted 1228
10 SASI_Hs01_00081385 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083988 predicted 432
2 SASI_Rn01_00083989 predicted 1499
3 SASI_Rn02_00270209 predicted 301
4 SASI_Rn01_00083990 predicted 594
5 SASI_Rn01_00083991 predicted 1226
6 SASI_Rn01_00083992 predicted 1321
7 SASI_Rn01_00083993 predicted 446
8 SASI_Rn01_00083994 predicted 568
9 SASI_Rn01_00083997 predicted 468
10 SASI_Rn02_00270210 predicted 1202
11 SASI_Rn01_00083995 predicted 312
12 SASI_Rn01_00083996 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117874 predicted 793
2 SASI_Mm01_00117875 predicted 536
3 SASI_Mm01_00117876 predicted 1204
4 SASI_Mm01_00117877 predicted 1284
5 SASI_Mm01_00117878 predicted 1219
6 SASI_Mm01_00117879 predicted 1301
7 SASI_Mm01_00117880 predicted 1389
8 SASI_Mm01_00117881 predicted 666
9 SASI_Mm01_00117882 predicted 1452
10 SASI_Mm01_00117883 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001382
VALIDATED
DPAGT1 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1263s1c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-447s1c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-1092s1c1
Sequence:CCGGCCTCTACTTCATGATACCCTTCTCGAGAAGGGTATCATGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-957s1c1
Sequence:CCGGCTGTACCAATGCCATCAATATCTCGAGATATTGATGGCATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1506s1c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1830s21c1
Sequence:CCGGTGCTGACTACTGATTGGATTTCTCGAGAAATCCAATCAGTAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-1263s21c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-447s21c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1506s21c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1233s21c1
Sequence:CCGGCAGCAAGACCATGCTACTATTCTCGAGAATAGTAGCATGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001382
VALIDATED
DPAGT1 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1263s1c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-447s1c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-1092s1c1
Sequence:CCGGCCTCTACTTCATGATACCCTTCTCGAGAAGGGTATCATGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-957s1c1
Sequence:CCGGCTGTACCAATGCCATCAATATCTCGAGATATTGATGGCATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1506s1c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1830s21c1
Sequence:CCGGTGCTGACTACTGATTGGATTTCTCGAGAAATCCAATCAGTAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-1263s21c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-447s21c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1506s21c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1233s21c1
Sequence:CCGGCAGCAAGACCATGCTACTATTCTCGAGAATAGTAGCATGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001382
VALIDATED
DPAGT1 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1263s1c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-447s1c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-1092s1c1
Sequence:CCGGCCTCTACTTCATGATACCCTTCTCGAGAAGGGTATCATGAAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001382.2-957s1c1
Sequence:CCGGCTGTACCAATGCCATCAATATCTCGAGATATTGATGGCATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001382.2-1506s1c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1830s21c1
Sequence:CCGGTGCTGACTACTGATTGGATTTCTCGAGAAATCCAATCAGTAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-1263s21c1
Sequence:CCGGCCAGGTGTTCAACTTCCTCTACTCGAGTAGAGGAAGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001382.3-447s21c1
Sequence:CCGGGCCGCTGCTGATCAATTTGATCTCGAGATCAAATTGATCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1506s21c1
Sequence:CCGGCCTCATCAACTTGCTACTTAACTCGAGTTAAGTAGCAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001382.3-1233s21c1
Sequence:CCGGCAGCAAGACCATGCTACTATTCTCGAGAATAGTAGCATGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007875
VALIDATED
DPAGT1 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1549s1c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1029s1c1
Sequence:CCGGCTCTTCTTTATGCCACAAGTACTCGAGTACTTGTGGCATAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-726s1c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1025s1c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1285s1c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1285s21c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1025s21c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-726s21c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007875.2-1549s21c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007875
VALIDATED
DPAGT1 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1549s1c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1029s1c1
Sequence:CCGGCTCTTCTTTATGCCACAAGTACTCGAGTACTTGTGGCATAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-726s1c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1025s1c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1285s1c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1285s21c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1025s21c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-726s21c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007875.2-1549s21c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007875
VALIDATED
DPAGT1 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1549s1c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1029s1c1
Sequence:CCGGCTCTTCTTTATGCCACAAGTACTCGAGTACTTGTGGCATAAAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-726s1c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1025s1c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007875.2-1285s1c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1285s21c1
Sequence:CCGGCCCTCATCAACTTGCTACTTACTCGAGTAAGTAGCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-1025s21c1
Sequence:CCGGGCTGCTCTTCTTTATGCCACACTCGAGTGTGGCATAAAGAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007875.2-726s21c1
Sequence:CCGGCTTGCAGTGTTCTGTACCAATCTCGAGATTGGTACAGAACACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007875.2-1549s21c1
Sequence:CCGGGCCATCTGTGACTACTGATATCTCGAGATATCAGTAGTCACAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks