EMAIL THIS PAGE TO A FRIEND

DPCD

deleted in primary ciliary dyskinesia homolog (mouse)

50 Gene Product Result for
UniProtKB ID: Q9BVM2, A8K289, Q6QNL3, Q8N5R1, Q9UFY6
Gene ID:
Mouse(226162) deleted in primary ciliary dyskinesia
Rat(294004) deleted in primary ciliary dyskinesia
Zebrafish(751660) deleted in a mouse model of primary ciliary dyskinesia
cow(516908) deleted in primary ciliary dyskinesia homolog (mouse)
domestic cat(101098012) deleted in primary ciliary dyskinesia homolog (mouse)
dog(477800) deleted in primary ciliary dyskinesia homolog (mouse)
chicken(423852) deleted in primary ciliary dyskinesia homolog (mouse)
naked mole-rat(101698206) deleted in primary ciliary dyskinesia homolog (mouse)
domestic guinea pig(100727977) deleted in primary ciliary dyskinesia homolog (mouse)
sheep(101103361) deleted in primary ciliary dyskinesia homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015448 Rosetta Predictions human pricing
NM_001013905 Rosetta Predictions rat pricing
NM_172639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148042 predicted 498
2 SASI_Hs01_00148043 predicted 331
3 SASI_Hs01_00148044 predicted 337
4 SASI_Hs01_00148045 predicted 417
5 SASI_Hs01_00148046 predicted 396
6 SASI_Hs01_00148047 predicted 244
7 SASI_Hs01_00148048 predicted 255
8 SASI_Hs01_00148049 predicted 465
9 SASI_Hs01_00148050 predicted 422
10 SASI_Hs01_00148051 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120455 predicted 221
2 SASI_Rn01_00120456 predicted 918
3 SASI_Rn01_00120457 predicted 947
4 SASI_Rn01_00120458 predicted 786
5 SASI_Rn01_00120459 predicted 1048
6 SASI_Rn02_00201190 predicted 996
7 SASI_Rn01_00120460 predicted 394
8 SASI_Rn01_00120461 predicted 1053
9 SASI_Rn01_00120462 predicted 483
10 SASI_Rn01_00120463 predicted 379
11 SASI_Rn01_00120464 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059603 predicted 1088
2 SASI_Mm01_00059604 predicted 792
3 SASI_Mm01_00059606 predicted 468
4 SASI_Mm01_00059607 predicted 674
5 SASI_Mm01_00059608 predicted 799
6 SASI_Mm02_00344344 predicted 832
7 SASI_Mm01_00059609 predicted 808
8 SASI_Mm01_00059610 predicted 1062
9 SASI_Mm01_00059611 predicted 778
10 SASI_Mm01_00059612 predicted 664
11 SASI_Mm01_00059605 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015448
VALIDATED
DPCD MISSION shRNA Bacterial Glycerol Stock
deleted in primary ciliary dyskinesia homolog (mouse)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-547s21c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-126s21c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-266s21c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-500s21c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-73s21c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-126s1c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015448.1-696s1c1
Sequence:CCGGCTCCTGTCTTCTAGGAGCTATCTCGAGATAGCTCCTAGAAGACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-500s1c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-266s1c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-392s1c1
Sequence:CCGGCAGAACAACCAACAAGAAGTACTCGAGTACTTCTTGTTGGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-73s1c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-249s1c1
Sequence:CCGGGAACTCATCAAGGAAAGCAATCTCGAGATTGCTTTCCTTGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-410s1c1
Sequence:CCGGGTACTACAAGAAGTTCTCCATCTCGAGATGGAGAACTTCTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-547s1c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015448
VALIDATED
DPCD MISSION shRNA shRNA Plasmid DNA
deleted in primary ciliary dyskinesia homolog (mouse)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-547s21c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-126s21c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-266s21c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-500s21c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-73s21c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-126s1c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015448.1-696s1c1
Sequence:CCGGCTCCTGTCTTCTAGGAGCTATCTCGAGATAGCTCCTAGAAGACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-500s1c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-266s1c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-392s1c1
Sequence:CCGGCAGAACAACCAACAAGAAGTACTCGAGTACTTCTTGTTGGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-73s1c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-249s1c1
Sequence:CCGGGAACTCATCAAGGAAAGCAATCTCGAGATTGCTTTCCTTGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-410s1c1
Sequence:CCGGGTACTACAAGAAGTTCTCCATCTCGAGATGGAGAACTTCTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-547s1c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015448
VALIDATED
DPCD MISSION shRNA Lentiviral Transduction Particles
deleted in primary ciliary dyskinesia homolog (mouse)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-547s21c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-126s21c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-266s21c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-500s21c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015448.1-73s21c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-126s1c1
Sequence:CCGGGACGAGAAGACGAGTGAACTACTCGAGTAGTTCACTCGTCTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015448.1-696s1c1
Sequence:CCGGCTCCTGTCTTCTAGGAGCTATCTCGAGATAGCTCCTAGAAGACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-500s1c1
Sequence:CCGGCCTGATCATCTCTTACCAGAACTCGAGTTCTGGTAAGAGATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-266s1c1
Sequence:CCGGCAATGCCAATCCTATCTTCATCTCGAGATGAAGATAGGATTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-392s1c1
Sequence:CCGGCAGAACAACCAACAAGAAGTACTCGAGTACTTCTTGTTGGTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-73s1c1
Sequence:CCGGGAAGGAAGGTTCACTATTTATCTCGAGATAAATAGTGAACCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-249s1c1
Sequence:CCGGGAACTCATCAAGGAAAGCAATCTCGAGATTGCTTTCCTTGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015448.1-410s1c1
Sequence:CCGGGTACTACAAGAAGTTCTCCATCTCGAGATGGAGAACTTCTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015448.1-547s1c1
Sequence:CCGGCTGAGCTACAGAAGGAACTAACTCGAGTTAGTTCCTTCTGTAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172639
VALIDATED
DPCD MISSION shRNA Bacterial Glycerol Stock
deleted in primary ciliary dyskinesia homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-519s21c1
Sequence:CCGGTGCACCCTGATAATCTCTTATCTCGAGATAAGAGATTATCAGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-333s21c1
Sequence:CCGGTTCCAGTGGCGGATTCGAAATCTCGAGATTTCGAATCCGCCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-572s21c1
Sequence:CCGGAGAGTTACAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172639.2-1092s21c1
Sequence:CCGGACGTTAAGACACTATGGTTAACTCGAGTTAACCATAGTGTCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-408s21c1
Sequence:CCGGGTCATTGTTAGAACGACAAACCTCGAGGTTTGTCGTTCTAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172639
VALIDATED
DPCD MISSION shRNA shRNA Plasmid DNA
deleted in primary ciliary dyskinesia homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-519s21c1
Sequence:CCGGTGCACCCTGATAATCTCTTATCTCGAGATAAGAGATTATCAGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-333s21c1
Sequence:CCGGTTCCAGTGGCGGATTCGAAATCTCGAGATTTCGAATCCGCCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-572s21c1
Sequence:CCGGAGAGTTACAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172639.2-1092s21c1
Sequence:CCGGACGTTAAGACACTATGGTTAACTCGAGTTAACCATAGTGTCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-408s21c1
Sequence:CCGGGTCATTGTTAGAACGACAAACCTCGAGGTTTGTCGTTCTAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172639
VALIDATED
DPCD MISSION shRNA Lentiviral Transduction Particles
deleted in primary ciliary dyskinesia homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-519s21c1
Sequence:CCGGTGCACCCTGATAATCTCTTATCTCGAGATAAGAGATTATCAGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-333s21c1
Sequence:CCGGTTCCAGTGGCGGATTCGAAATCTCGAGATTTCGAATCCGCCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-572s21c1
Sequence:CCGGAGAGTTACAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTGTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172639.2-1092s21c1
Sequence:CCGGACGTTAAGACACTATGGTTAACTCGAGTTAACCATAGTGTCTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172639.2-408s21c1
Sequence:CCGGGTCATTGTTAGAACGACAAACCTCGAGGTTTGTCGTTCTAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks