EMAIL THIS PAGE TO A FRIEND

DPCR1

diffuse panbronchiolitis critical region 1

46 Gene Product Result for
Synonyms: PBLT
UniProtKB ID: Q3MIW9, C9IZC0, Q658M7, Q8WYN2
Gene ID:
Mouse(268949) diffuse panbronchiolitis critical region 1 (human)
Rat(406199) diffuse panbronchiolitis critical region 1
cow(101907628) diffuse panbronchiolitis critical region 1
domestic guinea pig(101787546) diffuse panbronchiolitis critical region 1
naked mole-rat(101717068) diffuse panbronchiolitis critical region 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080870 Rosetta Predictions human pricing
NM_001003965 Rosetta Predictions rat pricing
NM_001033366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223493 predicted 1124
2 SASI_Hs01_00223494 predicted 443
3 SASI_Hs01_00223495 predicted 956
4 SASI_Hs01_00223497 predicted 262
5 SASI_Hs01_00223498 predicted 504
6 SASI_Hs01_00223499 predicted 407
7 SASI_Hs01_00223500 predicted 537
8 SASI_Hs01_00223501 predicted 737
9 SASI_Hs02_00362663 predicted 757
10 SASI_Hs02_00362664 predicted 522
11 SASI_Hs01_00223496 predicted 676
12 SASI_Hs01_00223502 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080741 predicted 596
2 SASI_Rn01_00080742 predicted 573
3 SASI_Rn01_00080743 predicted 716
4 SASI_Rn01_00080744 predicted 660
5 SASI_Rn01_00080745 predicted 344
6 SASI_Rn01_00080747 predicted 746
7 SASI_Rn01_00080748 predicted 743
8 SASI_Rn01_00080749 predicted 1252
9 SASI_Rn01_00080750 predicted 737
10 SASI_Rn02_00198076 predicted 739
11 SASI_Rn01_00080746 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151620 predicted 1464
2 SASI_Mm01_00151621 predicted 1454
3 SASI_Mm01_00151622 predicted 478
4 SASI_Mm01_00151623 predicted 1015
5 SASI_Mm01_00151624 predicted 538
6 SASI_Mm01_00151625 predicted 549
7 SASI_Mm01_00151626 predicted 1449
8 SASI_Mm02_00288665 predicted 735
9 SASI_Mm02_00288666 predicted 1325
10 SASI_Mm01_00151627 predicted 1116
11 SASI_Mm01_00151619 predicted 1593
12 SASI_Mm01_00151628 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080870
DPCR1 MISSION shRNA Bacterial Glycerol Stock
diffuse panbronchiolitis critical region 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-511s1c1
Sequence:CCGGCCTCATTACATCTAGAACGAACTCGAGTTCGTTCTAGATGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080870.2-926s1c1
Sequence:CCGGCCGGACTCACAATTTCTATTTCTCGAGAAATAGAAATTGTGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-241s1c1
Sequence:CCGGGCCTACGCTATACTCAGAGAACTCGAGTTCTCTGAGTATAGCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-764s1c1
Sequence:CCGGCAGTACAATGATGCAGAGGATCTCGAGATCCTCTGCATCATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-569s1c1
Sequence:CCGGAGCCATCCATACCTCAATAAACTCGAGTTTATTGAGGTATGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4591s21c1
Sequence:CCGGTGGGTTTCAGGACAGCATTATCTCGAGATAATGCTGTCCTGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4484s21c1
Sequence:CCGGACACTGCACTGAGTCCTAAAGCTCGAGCTTTAGGACTCAGTGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080870.3-3765s21c1
Sequence:CCGGTACTACCTCTTCTCATCTAAACTCGAGTTTAGATGAGAAGAGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080870
DPCR1 MISSION shRNA shRNA Plasmid DNA
diffuse panbronchiolitis critical region 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-511s1c1
Sequence:CCGGCCTCATTACATCTAGAACGAACTCGAGTTCGTTCTAGATGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080870.2-926s1c1
Sequence:CCGGCCGGACTCACAATTTCTATTTCTCGAGAAATAGAAATTGTGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-241s1c1
Sequence:CCGGGCCTACGCTATACTCAGAGAACTCGAGTTCTCTGAGTATAGCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-764s1c1
Sequence:CCGGCAGTACAATGATGCAGAGGATCTCGAGATCCTCTGCATCATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-569s1c1
Sequence:CCGGAGCCATCCATACCTCAATAAACTCGAGTTTATTGAGGTATGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4591s21c1
Sequence:CCGGTGGGTTTCAGGACAGCATTATCTCGAGATAATGCTGTCCTGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4484s21c1
Sequence:CCGGACACTGCACTGAGTCCTAAAGCTCGAGCTTTAGGACTCAGTGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080870.3-3765s21c1
Sequence:CCGGTACTACCTCTTCTCATCTAAACTCGAGTTTAGATGAGAAGAGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080870
DPCR1 MISSION shRNA Lentiviral Transduction Particles
diffuse panbronchiolitis critical region 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-511s1c1
Sequence:CCGGCCTCATTACATCTAGAACGAACTCGAGTTCGTTCTAGATGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080870.2-926s1c1
Sequence:CCGGCCGGACTCACAATTTCTATTTCTCGAGAAATAGAAATTGTGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-241s1c1
Sequence:CCGGGCCTACGCTATACTCAGAGAACTCGAGTTCTCTGAGTATAGCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-764s1c1
Sequence:CCGGCAGTACAATGATGCAGAGGATCTCGAGATCCTCTGCATCATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080870.2-569s1c1
Sequence:CCGGAGCCATCCATACCTCAATAAACTCGAGTTTATTGAGGTATGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4591s21c1
Sequence:CCGGTGGGTTTCAGGACAGCATTATCTCGAGATAATGCTGTCCTGAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080870.3-4484s21c1
Sequence:CCGGACACTGCACTGAGTCCTAAAGCTCGAGCTTTAGGACTCAGTGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080870.3-3765s21c1
Sequence:CCGGTACTACCTCTTCTCATCTAAACTCGAGTTTAGATGAGAAGAGGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033366
DPCR1 MISSION shRNA Bacterial Glycerol Stock
diffuse panbronchiolitis critical region 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1302s21c1
Sequence:CCGGCCCTGTGTGGGCTATAGTTATCTCGAGATAACTATAGCCCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-539s21c1
Sequence:CCGGGAACCAGCTTAACGACGAAATCTCGAGATTTCGTCGTTAAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1458s21c1
Sequence:CCGGCCGCAATTCCTACCCAGTTTACTCGAGTAAACTGGGTAGGAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033366.2-1965s21c1
Sequence:CCGGGAGATACCAGATATGTTTAAACTCGAGTTTAAACATATCTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1129s21c1
Sequence:CCGGGTCCCTTCTCATGTCCATAAACTCGAGTTTATGGACATGAGAAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033366
DPCR1 MISSION shRNA shRNA Plasmid DNA
diffuse panbronchiolitis critical region 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1302s21c1
Sequence:CCGGCCCTGTGTGGGCTATAGTTATCTCGAGATAACTATAGCCCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-539s21c1
Sequence:CCGGGAACCAGCTTAACGACGAAATCTCGAGATTTCGTCGTTAAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1458s21c1
Sequence:CCGGCCGCAATTCCTACCCAGTTTACTCGAGTAAACTGGGTAGGAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033366.2-1965s21c1
Sequence:CCGGGAGATACCAGATATGTTTAAACTCGAGTTTAAACATATCTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1129s21c1
Sequence:CCGGGTCCCTTCTCATGTCCATAAACTCGAGTTTATGGACATGAGAAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033366
DPCR1 MISSION shRNA Lentiviral Transduction Particles
diffuse panbronchiolitis critical region 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1302s21c1
Sequence:CCGGCCCTGTGTGGGCTATAGTTATCTCGAGATAACTATAGCCCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-539s21c1
Sequence:CCGGGAACCAGCTTAACGACGAAATCTCGAGATTTCGTCGTTAAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1458s21c1
Sequence:CCGGCCGCAATTCCTACCCAGTTTACTCGAGTAAACTGGGTAGGAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033366.2-1965s21c1
Sequence:CCGGGAGATACCAGATATGTTTAAACTCGAGTTTAAACATATCTGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033366.2-1129s21c1
Sequence:CCGGGTCCCTTCTCATGTCCATAAACTCGAGTTTATGGACATGAGAAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks