EMAIL THIS PAGE TO A FRIEND

DPEP1

dipeptidase 1 (renal)

70 Gene Product Result for
Synonyms: MBD1 MDP RDP
UniProtKB ID: P16444, D3DX80, Q96AK2
Gene ID:
Human(1800) Summary: The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(13479) dipeptidase 1 (renal)
Rat(94199) dipeptidase 1 (renal)
Zebrafish(768195) dipeptidase 1 (renal)
cow(514685) dipeptidase 1 (renal)
Horse(100052197) dipeptidase 1 (renal)
chicken(415842) dipeptidase 1 (renal)
dog(479611) dipeptidase 1 (renal)
naked mole-rat(101702619) dipeptidase 1 (renal)
domestic guinea pig(100731232) dipeptidase 1 (renal)
sheep(101107461) dipeptidase 1 (renal)
Domestic Rabbit(100009273) dipeptidase 1 (renal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128141 Rosetta Predictions human pricing
NM_004413 Rosetta Predictions human pricing
NM_053591 Rosetta Predictions rat pricing
NM_007876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330536 predicted 984
2 SASI_Hs02_00330537 predicted 402
3 SASI_Hs02_00330538 predicted 421
4 SASI_Hs02_00330539 predicted 722
5 SASI_Hs02_00330540 predicted 1241
6 SASI_Hs02_00330541 predicted 1179
7 SASI_Hs02_00330542 predicted 997
8 SASI_Hs02_00330543 predicted 427
9 SASI_Hs02_00330544 predicted 943
10 SASI_Hs02_00330545 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147752 predicted 1073
2 SASI_Hs01_00147753 predicted 495
3 SASI_Hs01_00147754 predicted 501
4 SASI_Hs01_00147755 predicted 810
5 SASI_Hs01_00147756 predicted 1331
6 SASI_Hs01_00147757 predicted 1263
7 SASI_Hs01_00147758 predicted 1082
8 SASI_Hs01_00147759 predicted 522
9 SASI_Hs01_00147760 predicted 1032
10 SASI_Hs01_00147761 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266261 predicted 466
2 SASI_Rn02_00266262 predicted 494
3 SASI_Rn02_00266263 predicted 497
4 SASI_Rn02_00266264 predicted 564
5 SASI_Rn02_00266265 predicted 923
6 SASI_Rn02_00266266 predicted 636
7 SASI_Rn02_00266267 predicted 860
8 SASI_Rn02_00266268 predicted 397
9 SASI_Rn01_00089937 predicted 1282
10 SASI_Rn02_00266269 predicted 879
11 SASI_Rn01_00089933 predicted 906
12 SASI_Rn01_00089934 predicted 1204
13 SASI_Rn01_00089935 predicted 1417
14 SASI_Rn01_00089936 predicted 251
15 SASI_Rn01_00089938 predicted 530
16 SASI_Rn01_00089939 predicted 269
17 SASI_Rn01_00089940 predicted 254
18 SASI_Rn01_00089941 predicted 656
19 SASI_Rn01_00089942 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312662 predicted 596
2 SASI_Mm01_00158988 predicted 253
3 SASI_Mm01_00158989 predicted 376
4 SASI_Mm01_00158990 predicted 1386
5 SASI_Mm01_00158991 predicted 990
6 SASI_Mm01_00158992 predicted 1031
7 SASI_Mm01_00158993 predicted 1275
8 SASI_Mm02_00312663 predicted 604
9 SASI_Mm01_00158994 predicted 1204
10 SASI_Mm01_00158995 predicted 288
11 SASI_Mm01_00158996 predicted 1302
12 SASI_Mm01_00158997 predicted 1359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007876
DPEP1 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 1 (renal)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1213s21c1
Sequence:CCGGCTAAGTACCCAGACCTGATAGCTCGAGCTATCAGGTCTGGGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007876.2-1949s21c1
Sequence:CCGGAGATATTCAGATGCATTATACCTCGAGGTATAATGCATCTGAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1279s21c1
Sequence:CCGGTGCTAGCTGACAACCTGATTCCTCGAGGAATCAGGTTGTCAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007876.1-1503s1c1
Sequence:CCGGCGGAACCTCCTCCAGTGCTCTCTCGAGAGAGCACTGGAGGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1162s1c1
Sequence:CCGGGAGGAGATTATGATGGTGTTACTCGAGTAACACCATCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-380s1c1
Sequence:CCGGGCAACTGCTAAATTTGTTCAACTCGAGTTGAACAAATTTAGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1060s1c1
Sequence:CCGGTCAGCAACTTTGTGTCCTGTTCTCGAGAACAGGACACAAAGTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-537s1c1
Sequence:CCGGGCCGTGAAGAGAATACTGGAACTCGAGTTCCAGTATTCTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007876
DPEP1 MISSION shRNA shRNA Plasmid DNA
dipeptidase 1 (renal)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1213s21c1
Sequence:CCGGCTAAGTACCCAGACCTGATAGCTCGAGCTATCAGGTCTGGGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007876.2-1949s21c1
Sequence:CCGGAGATATTCAGATGCATTATACCTCGAGGTATAATGCATCTGAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1279s21c1
Sequence:CCGGTGCTAGCTGACAACCTGATTCCTCGAGGAATCAGGTTGTCAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007876.1-1503s1c1
Sequence:CCGGCGGAACCTCCTCCAGTGCTCTCTCGAGAGAGCACTGGAGGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1162s1c1
Sequence:CCGGGAGGAGATTATGATGGTGTTACTCGAGTAACACCATCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-380s1c1
Sequence:CCGGGCAACTGCTAAATTTGTTCAACTCGAGTTGAACAAATTTAGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1060s1c1
Sequence:CCGGTCAGCAACTTTGTGTCCTGTTCTCGAGAACAGGACACAAAGTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-537s1c1
Sequence:CCGGGCCGTGAAGAGAATACTGGAACTCGAGTTCCAGTATTCTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007876
DPEP1 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 1 (renal)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1213s21c1
Sequence:CCGGCTAAGTACCCAGACCTGATAGCTCGAGCTATCAGGTCTGGGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007876.2-1949s21c1
Sequence:CCGGAGATATTCAGATGCATTATACCTCGAGGTATAATGCATCTGAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007876.2-1279s21c1
Sequence:CCGGTGCTAGCTGACAACCTGATTCCTCGAGGAATCAGGTTGTCAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007876.1-1503s1c1
Sequence:CCGGCGGAACCTCCTCCAGTGCTCTCTCGAGAGAGCACTGGAGGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1162s1c1
Sequence:CCGGGAGGAGATTATGATGGTGTTACTCGAGTAACACCATCATAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-380s1c1
Sequence:CCGGGCAACTGCTAAATTTGTTCAACTCGAGTTGAACAAATTTAGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-1060s1c1
Sequence:CCGGTCAGCAACTTTGTGTCCTGTTCTCGAGAACAGGACACAAAGTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007876.1-537s1c1
Sequence:CCGGGCCGTGAAGAGAATACTGGAACTCGAGTTCCAGTATTCTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004413
DPEP1 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 1 (renal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-550s21c1
Sequence:CCGGTGCGACACCCAGAACAAAGACCTCGAGGTCTTTGTTCTGGGTGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-1200s21c1
Sequence:CCGGGGACTTTGATGGTGTTCCAAGCTCGAGCTTGGAACACCATCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-421s1c1
Sequence:CCGGGCTGCTGGATATGTTCAACAACTCGAGTTGTTGAACATATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1249s1c1
Sequence:CCGGCTCCAAGTATCCAGACCTGATCTCGAGATCAGGTCTGGATACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-610s1c1
Sequence:CCGGCCACCGCATGTGCCGGATGTACTCGAGTACATCCGGCACATGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-724s1c1
Sequence:CCGGCCACTCCATTGACAGCAGTTTCTCGAGAAACTGCTGTCAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1078s1c1
Sequence:CCGGCCTGGTGATGGTGAACTTCTACTCGAGTAGAAGTTCACCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004413
DPEP1 MISSION shRNA shRNA Plasmid DNA
dipeptidase 1 (renal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-550s21c1
Sequence:CCGGTGCGACACCCAGAACAAAGACCTCGAGGTCTTTGTTCTGGGTGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-1200s21c1
Sequence:CCGGGGACTTTGATGGTGTTCCAAGCTCGAGCTTGGAACACCATCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-421s1c1
Sequence:CCGGGCTGCTGGATATGTTCAACAACTCGAGTTGTTGAACATATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1249s1c1
Sequence:CCGGCTCCAAGTATCCAGACCTGATCTCGAGATCAGGTCTGGATACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-610s1c1
Sequence:CCGGCCACCGCATGTGCCGGATGTACTCGAGTACATCCGGCACATGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-724s1c1
Sequence:CCGGCCACTCCATTGACAGCAGTTTCTCGAGAAACTGCTGTCAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1078s1c1
Sequence:CCGGCCTGGTGATGGTGAACTTCTACTCGAGTAGAAGTTCACCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004413
DPEP1 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 1 (renal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-550s21c1
Sequence:CCGGTGCGACACCCAGAACAAAGACCTCGAGGTCTTTGTTCTGGGTGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004413.3-1200s21c1
Sequence:CCGGGGACTTTGATGGTGTTCCAAGCTCGAGCTTGGAACACCATCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-421s1c1
Sequence:CCGGGCTGCTGGATATGTTCAACAACTCGAGTTGTTGAACATATCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1249s1c1
Sequence:CCGGCTCCAAGTATCCAGACCTGATCTCGAGATCAGGTCTGGATACTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-610s1c1
Sequence:CCGGCCACCGCATGTGCCGGATGTACTCGAGTACATCCGGCACATGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-724s1c1
Sequence:CCGGCCACTCCATTGACAGCAGTTTCTCGAGAAACTGCTGTCAATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004413.1-1078s1c1
Sequence:CCGGCCTGGTGATGGTGAACTTCTACTCGAGTAGAAGTTCACCATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks