EMAIL THIS PAGE TO A FRIEND

DPEP3

dipeptidase 3

55 Gene Product Result for
Synonyms: MBD3
UniProtKB ID: Q9H4B8, B3KQ48, Q6PEZ5, Q6UXE4
Gene ID:
Human(64180) Summary: This gene encodes a membrane-bound glycoprotein from the family of dipeptidases involved in hydrolytic metabolism of various dipeptides, including penem and carbapenem beta-lactam antibiotics. This gene is located on chromosome 16 in a cluster with another member of this family. Alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71854) dipeptidase 3
Rat(364994) dipeptidase 3
domestic cat(101091327) dipeptidase 3
cow(618258) dipeptidase 3
dog(489748) dipeptidase 3
sheep(101110613) dipeptidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022357 Rosetta Predictions human pricing
NM_001008383 Rosetta Predictions rat pricing
NM_027960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152833 predicted 787
2 SASI_Hs01_00152834 predicted 876
3 SASI_Hs01_00152835 predicted 1168
4 SASI_Hs01_00152836 predicted 1170
5 SASI_Hs01_00152837 predicted 820
6 SASI_Hs01_00152839 predicted 1167
7 SASI_Hs01_00152841 predicted 441
8 SASI_Hs01_00152842 predicted 474
9 SASI_Hs02_00355652 predicted 913
10 SASI_Hs02_00355653 predicted 1391
11 SASI_Hs01_00152838 predicted 1424
12 SASI_Hs01_00152840 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199159 predicted 728
2 SASI_Rn01_00030434 predicted 1431
3 SASI_Rn01_00030435 predicted 1153
4 SASI_Rn01_00030436 predicted 988
5 SASI_Rn01_00030438 predicted 975
6 SASI_Rn01_00030439 predicted 294
7 SASI_Rn01_00030440 predicted 1044
8 SASI_Rn01_00030441 predicted 761
9 SASI_Rn01_00030442 predicted 1141
10 SASI_Rn01_00030443 predicted 377
11 SASI_Rn01_00030437 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084914 predicted 995
2 SASI_Mm01_00084915 predicted 1162
3 SASI_Mm01_00084918 predicted 739
4 SASI_Mm02_00332986 predicted 1158
5 SASI_Mm02_00332987 predicted 829
6 SASI_Mm01_00084919 predicted 1017
7 SASI_Mm01_00084920 predicted 1003
8 SASI_Mm01_00084921 predicted 384
9 SASI_Mm01_00084922 predicted 203
10 SASI_Mm02_00332988 predicted 1031
11 SASI_Mm01_00084916 predicted 608
12 SASI_Mm01_00084917 predicted 740
13 SASI_Mm01_00084923 predicted 1291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027960
DPEP3 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-764s21c1
Sequence:CCGGAGTGCGCTACCTGACTCTTACCTCGAGGTAAGAGTCAGGTAGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-459s21c1
Sequence:CCGGGATGTGAATCTGCGCAATTTCCTCGAGGAAATTGCGCAGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1067s1c1
Sequence:CCGGGCATCGTGATGGTGACACTATCTCGAGATAGTGTCACCATCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-421s1c1
Sequence:CCGGCCTCTGCTCTTGAGAGAACTTCTCGAGAAGTTCTCTCAAGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-872s1c1
Sequence:CCGGGTGAGAAAGTAGTGGAAGAAACTCGAGTTTCTTCCACTACTTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1008s1c1
Sequence:CCGGGTGTGACAATTTGCTGAATATCTCGAGATATTCAGCAAATTGTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-845s1c1
Sequence:CCGGCCAACATTAGTGGGTTGACAACTCGAGTTGTCAACCCACTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027960
DPEP3 MISSION shRNA shRNA Plasmid DNA
dipeptidase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-764s21c1
Sequence:CCGGAGTGCGCTACCTGACTCTTACCTCGAGGTAAGAGTCAGGTAGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-459s21c1
Sequence:CCGGGATGTGAATCTGCGCAATTTCCTCGAGGAAATTGCGCAGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1067s1c1
Sequence:CCGGGCATCGTGATGGTGACACTATCTCGAGATAGTGTCACCATCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-421s1c1
Sequence:CCGGCCTCTGCTCTTGAGAGAACTTCTCGAGAAGTTCTCTCAAGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-872s1c1
Sequence:CCGGGTGAGAAAGTAGTGGAAGAAACTCGAGTTTCTTCCACTACTTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1008s1c1
Sequence:CCGGGTGTGACAATTTGCTGAATATCTCGAGATATTCAGCAAATTGTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-845s1c1
Sequence:CCGGCCAACATTAGTGGGTTGACAACTCGAGTTGTCAACCCACTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027960
DPEP3 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-764s21c1
Sequence:CCGGAGTGCGCTACCTGACTCTTACCTCGAGGTAAGAGTCAGGTAGCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027960.2-459s21c1
Sequence:CCGGGATGTGAATCTGCGCAATTTCCTCGAGGAAATTGCGCAGATTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1067s1c1
Sequence:CCGGGCATCGTGATGGTGACACTATCTCGAGATAGTGTCACCATCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-421s1c1
Sequence:CCGGCCTCTGCTCTTGAGAGAACTTCTCGAGAAGTTCTCTCAAGAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-872s1c1
Sequence:CCGGGTGAGAAAGTAGTGGAAGAAACTCGAGTTTCTTCCACTACTTTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-1008s1c1
Sequence:CCGGGTGTGACAATTTGCTGAATATCTCGAGATATTCAGCAAATTGTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027960.1-845s1c1
Sequence:CCGGCCAACATTAGTGGGTTGACAACTCGAGTTGTCAACCCACTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022357
DPEP3 MISSION shRNA Bacterial Glycerol Stock
dipeptidase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-961s1c1
Sequence:CCGGCCAGAGCTGTGTGTGACAATTCTCGAGAATTGTCACACACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-813s1c1
Sequence:CCGGGTCAGCGGATTGACAAGCTTTCTCGAGAAAGCTTGTCAATCCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-969s1c1
Sequence:CCGGGTGTGTGACAATTTGTTGAATCTCGAGATTCAACAAATTGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-1350s1c1
Sequence:CCGGGCTGAGTTTCCATATGGGCAACTCGAGTTGCCCATATGGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-399s1c1
Sequence:CCGGCAGCGTTACAAGAATGTGCTTCTCGAGAAGCACATTCTTGTAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022357
DPEP3 MISSION shRNA shRNA Plasmid DNA
dipeptidase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-961s1c1
Sequence:CCGGCCAGAGCTGTGTGTGACAATTCTCGAGAATTGTCACACACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-813s1c1
Sequence:CCGGGTCAGCGGATTGACAAGCTTTCTCGAGAAAGCTTGTCAATCCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-969s1c1
Sequence:CCGGGTGTGTGACAATTTGTTGAATCTCGAGATTCAACAAATTGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-1350s1c1
Sequence:CCGGGCTGAGTTTCCATATGGGCAACTCGAGTTGCCCATATGGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-399s1c1
Sequence:CCGGCAGCGTTACAAGAATGTGCTTCTCGAGAAGCACATTCTTGTAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022357
DPEP3 MISSION shRNA Lentiviral Transduction Particles
dipeptidase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-961s1c1
Sequence:CCGGCCAGAGCTGTGTGTGACAATTCTCGAGAATTGTCACACACAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-813s1c1
Sequence:CCGGGTCAGCGGATTGACAAGCTTTCTCGAGAAAGCTTGTCAATCCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-969s1c1
Sequence:CCGGGTGTGTGACAATTTGTTGAATCTCGAGATTCAACAAATTGTCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-1350s1c1
Sequence:CCGGGCTGAGTTTCCATATGGGCAACTCGAGTTGCCCATATGGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022357.1-399s1c1
Sequence:CCGGCAGCGTTACAAGAATGTGCTTCTCGAGAAGCACATTCTTGTAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks