EMAIL THIS PAGE TO A FRIEND

DPF1

D4, zinc and double PHD fingers family 1

70 Gene Product Result for
Synonyms: BAF45b NEUD4 neuro-d4
UniProtKB ID: Q92782, B3KSY8, Q08AJ0
Gene ID:
Mouse(29861) D4, zinc and double PHD fingers family 1
Rat(50545) D4, zinc and double PHD fingers family 1
Zebrafish(566219) D4, zinc and double PHD fingers family 1
domestic cat(101080499) D4, zinc and double PHD fingers family 1
cow(515409) D4, zinc and double PHD fingers family 1
dog(484535) D4, zinc and double PHD fingers family 1
chicken(395352) D4, zinc and double PHD fingers family 1
sheep(101110262) D4, zinc and double PHD fingers family 1
domestic guinea pig(100725640) D4, zinc and double PHD fingers family 1
naked mole-rat(101701672) D4, zinc and double PHD fingers family 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151411 MISSION® esiRNA esiRNA human DPF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004647 Rosetta Predictions human pricing
NM_001105729 Rosetta Predictions rat pricing
NM_013874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217163 predicted 235
2 SASI_Hs01_00217164 predicted 583
3 SASI_Hs01_00217165 predicted 446
4 SASI_Hs01_00217166 predicted 277
5 SASI_Hs01_00217167 predicted 569
6 SASI_Hs02_00338058 predicted 462
7 SASI_Hs01_00217168 predicted 436
8 SASI_Hs01_00217169 predicted 351
9 SASI_Hs01_00217171 predicted 416
10 SASI_Hs01_00217172 predicted 283
11 SASI_Hs01_00217170 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211956 predicted 954
2 SASI_Rn02_00211957 predicted 294
3 SASI_Rn02_00211958 predicted 1016
4 SASI_Rn02_00211959 predicted 1138
5 SASI_Rn02_00211960 predicted 524
6 SASI_Rn02_00211961 predicted 893
7 SASI_Rn02_00211962 predicted 904
8 SASI_Rn02_00211963 predicted 512
9 SASI_Rn02_00211964 predicted 811
10 SASI_Rn02_00211965 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067518 predicted 660
2 SASI_Mm01_00067519 predicted 369
3 SASI_Mm01_00067520 predicted 527
4 SASI_Mm01_00067521 predicted 972
5 SASI_Mm01_00067522 predicted 981
6 SASI_Mm01_00067524 predicted 511
7 SASI_Mm01_00067525 predicted 943
8 SASI_Mm02_00322888 predicted 324
9 SASI_Mm02_00322889 predicted 446
10 SASI_Mm01_00067526 predicted 434
11 SASI_Mm01_00067517 predicted 1062
12 SASI_Mm01_00067523 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004647
VALIDATED
DPF1 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers family 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1206s1c1
Sequence:CCGGCCCTCTGTGCAAGTGGAATGTCTCGAGACATTCCACTTGCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004647.1-585s1c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-292s1c1
Sequence:CCGGGAGTACAAGATCGACTGTGAACTCGAGTTCACAGTCGATCTTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1047s1c1
Sequence:CCGGTGCTTACATCACCCTCACCTACTCGAGTAGGTGAGGGTGATGTAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-783s1c1
Sequence:CCGGGTGTTTACAATTCACGGTGAACTCGAGTTCACCGTGAATTGTAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-585s21c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-441s21c1
Sequence:CCGGGTTGCTGGAGTTTCCGCATGACTCGAGTCATGCGGAAACTCCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-416s21c1
Sequence:CCGGCCATTATGGACTGTCAGAAACCTCGAGGTTTCTGACAGTCCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004647.1-1116s21c1
Sequence:CCGGTCTCCGAGCTCCTCAATTCTCCTCGAGGAGAATTGAGGAGCTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-290s21c1
Sequence:CCGGGCGAGTACAAGATCGACTGTGCTCGAGCACAGTCGATCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004647
VALIDATED
DPF1 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers family 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1206s1c1
Sequence:CCGGCCCTCTGTGCAAGTGGAATGTCTCGAGACATTCCACTTGCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004647.1-585s1c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-292s1c1
Sequence:CCGGGAGTACAAGATCGACTGTGAACTCGAGTTCACAGTCGATCTTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1047s1c1
Sequence:CCGGTGCTTACATCACCCTCACCTACTCGAGTAGGTGAGGGTGATGTAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-783s1c1
Sequence:CCGGGTGTTTACAATTCACGGTGAACTCGAGTTCACCGTGAATTGTAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-585s21c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-441s21c1
Sequence:CCGGGTTGCTGGAGTTTCCGCATGACTCGAGTCATGCGGAAACTCCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-416s21c1
Sequence:CCGGCCATTATGGACTGTCAGAAACCTCGAGGTTTCTGACAGTCCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004647.1-1116s21c1
Sequence:CCGGTCTCCGAGCTCCTCAATTCTCCTCGAGGAGAATTGAGGAGCTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-290s21c1
Sequence:CCGGGCGAGTACAAGATCGACTGTGCTCGAGCACAGTCGATCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004647
VALIDATED
DPF1 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers family 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1206s1c1
Sequence:CCGGCCCTCTGTGCAAGTGGAATGTCTCGAGACATTCCACTTGCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004647.1-585s1c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-292s1c1
Sequence:CCGGGAGTACAAGATCGACTGTGAACTCGAGTTCACAGTCGATCTTGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-1047s1c1
Sequence:CCGGTGCTTACATCACCCTCACCTACTCGAGTAGGTGAGGGTGATGTAAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004647.1-783s1c1
Sequence:CCGGGTGTTTACAATTCACGGTGAACTCGAGTTCACCGTGAATTGTAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-585s21c1
Sequence:CCGGGCCGTATGTCTGTGATAAGTTCTCGAGAACTTATCACAGACATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-441s21c1
Sequence:CCGGGTTGCTGGAGTTTCCGCATGACTCGAGTCATGCGGAAACTCCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-416s21c1
Sequence:CCGGCCATTATGGACTGTCAGAAACCTCGAGGTTTCTGACAGTCCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004647.1-1116s21c1
Sequence:CCGGTCTCCGAGCTCCTCAATTCTCCTCGAGGAGAATTGAGGAGCTCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004647.1-290s21c1
Sequence:CCGGGCGAGTACAAGATCGACTGTGCTCGAGCACAGTCGATCTTGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013874
DPF1 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers family 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013874.1-1437s1c1
Sequence:CCGGCCCTCTTCATCCCTTGACAAACTCGAGTTTGTCAAGGGATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-538s1c1
Sequence:CCGGGAGGTAGAAGACTTGGAGGAACTCGAGTTCCTCCAAGTCTTCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-987s1c1
Sequence:CCGGGTGTTTACAGTTCACGGTGAACTCGAGTTCACCGTGAACTGTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-359s1c1
Sequence:CCGGCCTGCGAGTACAAGATCGATTCTCGAGAATCGATCTTGTACTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-772s1c1
Sequence:CCGGGCCCTGCCTTTCCACCGGAAACTCGAGTTTCCGGTGGAAAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-674s21c1
Sequence:CCGGATCTGTGGGAAGAGATATAAGCTCGAGCTTATATCTCTTCCCACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-1116s21c1
Sequence:CCGGGCGATCGAGGTTACCACATGTCTCGAGACATGTGGTAACCTCGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013874.2-1605s21c1
Sequence:CCGGTATACAAAGAGTCCTATAAAGCTCGAGCTTTATAGGACTCTTTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-515s21c1
Sequence:CCGGTTGCTGGAGTTTCCGCATGATCTCGAGATCATGCGGAAACTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013874
DPF1 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers family 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013874.1-1437s1c1
Sequence:CCGGCCCTCTTCATCCCTTGACAAACTCGAGTTTGTCAAGGGATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-538s1c1
Sequence:CCGGGAGGTAGAAGACTTGGAGGAACTCGAGTTCCTCCAAGTCTTCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-987s1c1
Sequence:CCGGGTGTTTACAGTTCACGGTGAACTCGAGTTCACCGTGAACTGTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-359s1c1
Sequence:CCGGCCTGCGAGTACAAGATCGATTCTCGAGAATCGATCTTGTACTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-772s1c1
Sequence:CCGGGCCCTGCCTTTCCACCGGAAACTCGAGTTTCCGGTGGAAAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-674s21c1
Sequence:CCGGATCTGTGGGAAGAGATATAAGCTCGAGCTTATATCTCTTCCCACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-1116s21c1
Sequence:CCGGGCGATCGAGGTTACCACATGTCTCGAGACATGTGGTAACCTCGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013874.2-1605s21c1
Sequence:CCGGTATACAAAGAGTCCTATAAAGCTCGAGCTTTATAGGACTCTTTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-515s21c1
Sequence:CCGGTTGCTGGAGTTTCCGCATGATCTCGAGATCATGCGGAAACTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013874
DPF1 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers family 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013874.1-1437s1c1
Sequence:CCGGCCCTCTTCATCCCTTGACAAACTCGAGTTTGTCAAGGGATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-538s1c1
Sequence:CCGGGAGGTAGAAGACTTGGAGGAACTCGAGTTCCTCCAAGTCTTCTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-987s1c1
Sequence:CCGGGTGTTTACAGTTCACGGTGAACTCGAGTTCACCGTGAACTGTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-359s1c1
Sequence:CCGGCCTGCGAGTACAAGATCGATTCTCGAGAATCGATCTTGTACTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013874.1-772s1c1
Sequence:CCGGGCCCTGCCTTTCCACCGGAAACTCGAGTTTCCGGTGGAAAGGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-674s21c1
Sequence:CCGGATCTGTGGGAAGAGATATAAGCTCGAGCTTATATCTCTTCCCACAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-1116s21c1
Sequence:CCGGGCGATCGAGGTTACCACATGTCTCGAGACATGTGGTAACCTCGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013874.2-1605s21c1
Sequence:CCGGTATACAAAGAGTCCTATAAAGCTCGAGCTTTATAGGACTCTTTGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013874.2-515s21c1
Sequence:CCGGTTGCTGGAGTTTCCGCATGATCTCGAGATCATGCGGAAACTCCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks