EMAIL THIS PAGE TO A FRIEND

DPF2

D4, zinc and double PHD fingers family 2

124 Gene Product Result for
Synonyms: REQ UBID4 ubi-d4
UniProtKB ID: Q92785, A8K7C9
Gene ID:
Human(5977) Summary: The protein encoded by this gene is a member of the d4 domain family, characterized by a zinc finger-like structural motif. This protein functions as a transcription factor which is necessary for the apoptotic response following deprivation of survival factors. It likely serves a regulatory role in rapid hematopoietic cell growth and turnover. This gene is considered a candidate gene for multiple endocrine neoplasia type I, an inherited cancer syndrome involving multiple parathyroid, enteropancreatic, and pituitary tumors. [provided by RefSeq, Jul 2008]
Mouse(19708) D4, zinc and double PHD fingers family 2
Rat(361711) D4, zinc and double PHD fingers family 2
naked mole-rat(101724558) D4, zinc and double PHD fingers family 2
domestic guinea pig(100728138) D4, zinc and double PHD fingers family 2
sheep(101107647) D4, zinc and double PHD fingers family 2
Domestic Rabbit(100355425) D4, zinc and double PHD fingers family 2
Zebrafish(474324) D4, zinc and double PHD fingers family 2
cow(513235) D4, zinc and double PHD fingers family 2
Horse(100051328) D4, zinc and double PHD fingers family 2
domestic cat(101085317) D4, zinc and double PHD fingers family 2
dog(483743) D4, zinc and double PHD fingers family 2
chicken(374236) D4, zinc and double PHD fingers family 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100398 Anti-DPF2 (126-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100399 Anti-DPF2 (171-185) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV38768 Anti-DPF2 antibody produced in rabbit IgG fraction of antiserum horse, bovine, human, canine, rabbit, zebrafish, mouse, guinea pig, rat
western blot pricing
HPA020880 Anti-DPF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100615 Anti-DPF2 antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, zebrafish, human, horse, rabbit, bovine, canine
western blot pricing
SAB2104037 Anti-DPF2 antibody produced in rabbit affinity isolated antibody rat, canine, horse, zebrafish, guinea pig, mouse, bovine, rabbit, human,
western blot pricing
SAB2104355 Anti-DPF2 antibody produced in rabbit affinity isolated antibody , guinea pig, human, rat, mouse, horse, rabbit, bovine, canine
western blot pricing
HPA056786 Anti-DPF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4502621 Anti-REQU antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing
SAB3500605 Anti-REQUIEM antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0005977M1 Monoclonal Anti-DPF2 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006268 Rosetta Predictions human pricing
NM_001108516 Rosetta Predictions rat pricing
NM_011262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124926 predicted 909
2 SASI_Hs01_00124930 predicted 276
3 SASI_Hs01_00124931 predicted 733
4 SASI_Hs01_00124932 predicted 921
5 SASI_Hs01_00124934 predicted 1210
6 SASI_Hs01_00124935 predicted 1151
7 SASI_Hs02_00341226 predicted 1155
8 SASI_Hs02_00341227 predicted 1205
9 SASI_Hs02_00341228 predicted 1137
10 SASI_Hs01_00124927 predicted 1233
11 SASI_Hs01_00124928 predicted 852
12 SASI_Hs01_00124929 predicted 822
13 SASI_Hs01_00124933 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239419 predicted 1453
2 SASI_Rn02_00239420 predicted 201
3 SASI_Rn02_00239421 predicted 1486
4 SASI_Rn02_00239422 predicted 1504
5 SASI_Rn02_00239423 predicted 318
6 SASI_Rn02_00239424 predicted 1171
7 SASI_Rn02_00239425 predicted 1245
8 SASI_Rn02_00239426 predicted 868
9 SASI_Rn02_00239427 predicted 1297
10 SASI_Rn02_00239428 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320267 predicted 304
2 SASI_Mm02_00320268 predicted 1466
3 SASI_Mm01_00144661 predicted 464
4 SASI_Mm01_00144662 predicted 537
5 SASI_Mm01_00144663 predicted 814
6 SASI_Mm01_00144666 predicted 901
7 SASI_Mm01_00144667 predicted 491
8 SASI_Mm01_00144668 predicted 1179
9 SASI_Mm02_00320269 predicted 590
10 SASI_Mm02_00320270 predicted 221
11 SASI_Mm01_00144659 predicted 1523
12 SASI_Mm01_00144660 predicted 1502
13 SASI_Mm01_00144664 predicted 204
14 SASI_Mm01_00144665 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006268
VALIDATED
DPF2 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers family 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1425s21c1
Sequence:GTACCGGGTTTCTCTCTGCTCTCCATTACTCGAGTAATGGAGAGCAGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-509s21c1
Sequence:GTACCGGACCTCGATGATGAAGACTATGCTCGAGCATAGTCTTCATCATCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-804s21c1
Sequence:GTACCGGTGGATTGGCCTTGCCCAACAACTCGAGTTGTTGGGCAAGGCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-71s21c1
Sequence:GTACCGGCCATGGAGCAGTGCCACAATTCTCGAGAATTGTGGCACTGCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-632s21c1
Sequence:GTACCGGAGCCCTATGCCTGTGACATTTCTCGAGAAATGTCACAGGCATAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-431s21c1
Sequence:GTACCGGATGACAGCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-154s21c1
Sequence:GTACCGGGTAGCCCAGAGCAATTGTTACCTCGAGGTAACAATTGCTCTGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-986s21c1
Sequence:GTACCGGTCGAGTGCAAATGTTGCAATACTCGAGTATTGCAACATTTGCACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-1804s21c1
Sequence:GTACCGGCAGTAGCTTCACCTTGTTATTCTCGAGAATAACAAGGTGAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-921s21c1
Sequence:CCGGTCCATCTTGCCTCCAATTTACCTCGAGGTAAATTGGAGGCAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-349s21c1
Sequence:CCGGTCTCAGGATGGCAGTAGTTTACTCGAGTAAACTACTGCCATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-288s21c1
Sequence:CCGGACTTTCCTTCCCATCTATTAACTCGAGTTAATAGATGGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1270s21c1
Sequence:GTACCGGTCCTCCTCTCCTTCACAAATCCTCGAGGATTTGTGAAGGAGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1209s1c1
Sequence:CCGGCCGACATATCTAAGGCTGTTTCTCGAGAAACAGCCTTAGATATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006268.3-286s1c1
Sequence:CCGGCGACTTTCCTTCCCATCTATTCTCGAGAATAGATGGGAAGGAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1135s1c1
Sequence:CCGGCTGGACCTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-54s1c1
Sequence:CCGGGCAGTACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-987s1c1
Sequence:CCGGCGAGTGCAAATGTTGCAATATCTCGAGATATTGCAACATTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006268
VALIDATED
DPF2 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers family 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1425s21c1
Sequence:GTACCGGGTTTCTCTCTGCTCTCCATTACTCGAGTAATGGAGAGCAGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-509s21c1
Sequence:GTACCGGACCTCGATGATGAAGACTATGCTCGAGCATAGTCTTCATCATCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-804s21c1
Sequence:GTACCGGTGGATTGGCCTTGCCCAACAACTCGAGTTGTTGGGCAAGGCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-71s21c1
Sequence:GTACCGGCCATGGAGCAGTGCCACAATTCTCGAGAATTGTGGCACTGCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-632s21c1
Sequence:GTACCGGAGCCCTATGCCTGTGACATTTCTCGAGAAATGTCACAGGCATAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-431s21c1
Sequence:GTACCGGATGACAGCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-154s21c1
Sequence:GTACCGGGTAGCCCAGAGCAATTGTTACCTCGAGGTAACAATTGCTCTGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-986s21c1
Sequence:GTACCGGTCGAGTGCAAATGTTGCAATACTCGAGTATTGCAACATTTGCACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-1804s21c1
Sequence:GTACCGGCAGTAGCTTCACCTTGTTATTCTCGAGAATAACAAGGTGAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-921s21c1
Sequence:CCGGTCCATCTTGCCTCCAATTTACCTCGAGGTAAATTGGAGGCAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-349s21c1
Sequence:CCGGTCTCAGGATGGCAGTAGTTTACTCGAGTAAACTACTGCCATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-288s21c1
Sequence:CCGGACTTTCCTTCCCATCTATTAACTCGAGTTAATAGATGGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1270s21c1
Sequence:GTACCGGTCCTCCTCTCCTTCACAAATCCTCGAGGATTTGTGAAGGAGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1209s1c1
Sequence:CCGGCCGACATATCTAAGGCTGTTTCTCGAGAAACAGCCTTAGATATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006268.3-286s1c1
Sequence:CCGGCGACTTTCCTTCCCATCTATTCTCGAGAATAGATGGGAAGGAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1135s1c1
Sequence:CCGGCTGGACCTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-54s1c1
Sequence:CCGGGCAGTACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-987s1c1
Sequence:CCGGCGAGTGCAAATGTTGCAATATCTCGAGATATTGCAACATTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006268
VALIDATED
DPF2 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers family 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1425s21c1
Sequence:GTACCGGGTTTCTCTCTGCTCTCCATTACTCGAGTAATGGAGAGCAGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-509s21c1
Sequence:GTACCGGACCTCGATGATGAAGACTATGCTCGAGCATAGTCTTCATCATCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-804s21c1
Sequence:GTACCGGTGGATTGGCCTTGCCCAACAACTCGAGTTGTTGGGCAAGGCCAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-71s21c1
Sequence:GTACCGGCCATGGAGCAGTGCCACAATTCTCGAGAATTGTGGCACTGCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-632s21c1
Sequence:GTACCGGAGCCCTATGCCTGTGACATTTCTCGAGAAATGTCACAGGCATAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-431s21c1
Sequence:GTACCGGATGACAGCCTGGGCGAGTTTCCTCGAGGAAACTCGCCCAGGCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-154s21c1
Sequence:GTACCGGGTAGCCCAGAGCAATTGTTACCTCGAGGTAACAATTGCTCTGGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-986s21c1
Sequence:GTACCGGTCGAGTGCAAATGTTGCAATACTCGAGTATTGCAACATTTGCACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-1804s21c1
Sequence:GTACCGGCAGTAGCTTCACCTTGTTATTCTCGAGAATAACAAGGTGAAGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-921s21c1
Sequence:CCGGTCCATCTTGCCTCCAATTTACCTCGAGGTAAATTGGAGGCAAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006268.3-349s21c1
Sequence:CCGGTCTCAGGATGGCAGTAGTTTACTCGAGTAAACTACTGCCATCCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006268.3-288s21c1
Sequence:CCGGACTTTCCTTCCCATCTATTAACTCGAGTTAATAGATGGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006268.3-1270s21c1
Sequence:GTACCGGTCCTCCTCTCCTTCACAAATCCTCGAGGATTTGTGAAGGAGAGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1209s1c1
Sequence:CCGGCCGACATATCTAAGGCTGTTTCTCGAGAAACAGCCTTAGATATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006268.3-286s1c1
Sequence:CCGGCGACTTTCCTTCCCATCTATTCTCGAGAATAGATGGGAAGGAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006268.3-1135s1c1
Sequence:CCGGCTGGACCTGTTGAAAGAGAAACTCGAGTTTCTCTTTCAACAGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-54s1c1
Sequence:CCGGGCAGTACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006268.3-987s1c1
Sequence:CCGGCGAGTGCAAATGTTGCAATATCTCGAGATATTGCAACATTTGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011262
VALIDATED
DPF2 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers family 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000365869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-94s21c1
Sequence:CCGGATGGAACAGTGCCACAATTATCTCGAGATAATTGTGGCACTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-310s21c1
Sequence:CCGGCTTTCTTTCCCATCGATTAAACTCGAGTTTAATCGATGGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-60s21c1
Sequence:CCGGGAAGCTCCTTGGCGAGCAATACTCGAGTATTGCTCGCCAAGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-175s21c1
Sequence:CCGGGTAGCCCAGAGCAATTGTTATCTCGAGATAACAATTGCTCTGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-547s21c1
Sequence:CCGGTATGAAGAAGATACGCCAAAGCTCGAGCTTTGGCGTATCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-371s21c1
Sequence:CCGGCTCAGGATGGCAGCAGTTTAGCTCGAGCTAAACTGCTGCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-228s21c1
Sequence:CCGGATTGGCCTCTGGACAGTTATACTCGAGTATAACTGTCCAGAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-1459s21c1
Sequence:CCGGGGCCTAAGACCCTGGTGATTACTCGAGTAATCACCAGGGTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011262.1-1482s1c1
Sequence:CCGGCCTGGTGATTACAGGGTCAAACTCGAGTTTGACCCTGTAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-324s1c1
Sequence:CCGGCAGGCTTTCTTTCCCATCGATCTCGAGATCGATGGGAAAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-526s1c1
Sequence:CCGGGAACCCGATGACTTCCTTGATCTCGAGATCAAGGAAGTCATCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011262.1-855s1c1
Sequence:CCGGGCCTAACAACTACTGTGACTTCTCGAGAAGTCACAGTAGTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-93s1c1
Sequence:CCGGGCAATACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011262
VALIDATED
DPF2 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers family 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000365869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-94s21c1
Sequence:CCGGATGGAACAGTGCCACAATTATCTCGAGATAATTGTGGCACTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-310s21c1
Sequence:CCGGCTTTCTTTCCCATCGATTAAACTCGAGTTTAATCGATGGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-60s21c1
Sequence:CCGGGAAGCTCCTTGGCGAGCAATACTCGAGTATTGCTCGCCAAGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-175s21c1
Sequence:CCGGGTAGCCCAGAGCAATTGTTATCTCGAGATAACAATTGCTCTGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-547s21c1
Sequence:CCGGTATGAAGAAGATACGCCAAAGCTCGAGCTTTGGCGTATCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-371s21c1
Sequence:CCGGCTCAGGATGGCAGCAGTTTAGCTCGAGCTAAACTGCTGCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-228s21c1
Sequence:CCGGATTGGCCTCTGGACAGTTATACTCGAGTATAACTGTCCAGAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-1459s21c1
Sequence:CCGGGGCCTAAGACCCTGGTGATTACTCGAGTAATCACCAGGGTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011262.1-1482s1c1
Sequence:CCGGCCTGGTGATTACAGGGTCAAACTCGAGTTTGACCCTGTAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-324s1c1
Sequence:CCGGCAGGCTTTCTTTCCCATCGATCTCGAGATCGATGGGAAAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-526s1c1
Sequence:CCGGGAACCCGATGACTTCCTTGATCTCGAGATCAAGGAAGTCATCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011262.1-855s1c1
Sequence:CCGGGCCTAACAACTACTGTGACTTCTCGAGAAGTCACAGTAGTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-93s1c1
Sequence:CCGGGCAATACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011262
VALIDATED
DPF2 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers family 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000365869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-94s21c1
Sequence:CCGGATGGAACAGTGCCACAATTATCTCGAGATAATTGTGGCACTGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-310s21c1
Sequence:CCGGCTTTCTTTCCCATCGATTAAACTCGAGTTTAATCGATGGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-60s21c1
Sequence:CCGGGAAGCTCCTTGGCGAGCAATACTCGAGTATTGCTCGCCAAGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-175s21c1
Sequence:CCGGGTAGCCCAGAGCAATTGTTATCTCGAGATAACAATTGCTCTGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-547s21c1
Sequence:CCGGTATGAAGAAGATACGCCAAAGCTCGAGCTTTGGCGTATCTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-371s21c1
Sequence:CCGGCTCAGGATGGCAGCAGTTTAGCTCGAGCTAAACTGCTGCCATCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011262.3-228s21c1
Sequence:CCGGATTGGCCTCTGGACAGTTATACTCGAGTATAACTGTCCAGAGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011262.3-1459s21c1
Sequence:CCGGGGCCTAAGACCCTGGTGATTACTCGAGTAATCACCAGGGTCTTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011262.1-1482s1c1
Sequence:CCGGCCTGGTGATTACAGGGTCAAACTCGAGTTTGACCCTGTAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-324s1c1
Sequence:CCGGCAGGCTTTCTTTCCCATCGATCTCGAGATCGATGGGAAAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-526s1c1
Sequence:CCGGGAACCCGATGACTTCCTTGATCTCGAGATCAAGGAAGTCATCGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011262.1-855s1c1
Sequence:CCGGGCCTAACAACTACTGTGACTTCTCGAGAAGTCACAGTAGTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011262.1-93s1c1
Sequence:CCGGGCAATACTACAAAGATGCCATCTCGAGATGGCATCTTTGTAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks