EMAIL THIS PAGE TO A FRIEND

DPF3

D4, zinc and double PHD fingers, family 3

82 Gene Product Result for
Synonyms: BAF45C CERD4
UniProtKB ID: Q92784, A8MSI3, Q32UJ0, Q6P9E6, Q6ZT41, Q9H7Y5
Gene ID:
Mouse(70127) D4, zinc and double PHD fingers, family 3
Rat(299186) D4, zinc and double PHD fingers, family 3
Zebrafish(562738) D4, zinc and double PHD fingers, family 3
cow(787359) D4, zinc and double PHD fingers, family 3
domestic cat(101085217) D4, zinc and double PHD fingers, family 3
dog(611798) D4, zinc and double PHD fingers, family 3
chicken(395351) D4, zinc and double PHD fingers, family 3
sheep(101103652) D4, zinc and double PHD fingers, family 3
domestic guinea pig(100717567) D4, zinc and double PHD fingers, family 3
naked mole-rat(101720129) D4, zinc and double PHD fingers, family 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_058212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_058212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_058212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012074 Rosetta Predictions human pricing
XM_001055009 Rosetta Predictions rat pricing
XM_238462 Rosetta Predictions rat pricing
NM_058212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343551 predicted 717
2 SASI_Hs01_00145893 predicted 331
3 SASI_Hs02_00343552 predicted 931
4 SASI_Hs01_00145897 predicted 496
5 SASI_Hs02_00343553 predicted 762
6 SASI_Hs02_00343554 predicted 771
7 SASI_Hs02_00343555 predicted 596
8 SASI_Hs02_00343556 predicted 654
9 SASI_Hs02_00343557 predicted 873
10 SASI_Hs01_00145899 predicted 429
11 SASI_Hs01_00145894 predicted 864
12 SASI_Hs01_00145895 predicted 424
13 SASI_Hs01_00145896 predicted 864
14 SASI_Hs01_00145898 predicted 851
15 SASI_Hs01_00145900 predicted 741
16 SASI_Hs01_00145901 predicted 948
17 SASI_Hs01_00145902 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278062 predicted 472
2 SASI_Rn02_00278063 predicted 1033
3 SASI_Rn02_00278064 predicted 857
4 SASI_Rn02_00278065 predicted 782
5 SASI_Rn02_00278066 predicted 204
6 SASI_Rn02_00278067 predicted 1015
7 SASI_Rn02_00278068 predicted 694
8 SASI_Rn02_00278069 predicted 858
9 SASI_Rn02_00278070 predicted 973
10 SASI_Rn02_00278071 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391346 predicted 1342
2 SASI_Rn02_00391347 predicted 1372
3 SASI_Rn02_00391348 predicted 1143
4 SASI_Rn02_00391349 predicted 1186
5 SASI_Rn02_00391350 predicted 1168
6 SASI_Rn02_00391351 predicted 1283
7 SASI_Rn02_00391352 predicted 914
8 SASI_Rn02_00391353 predicted 1451
9 SASI_Rn02_00391354 predicted 1171
10 SASI_Rn02_00391355 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196269 predicted 708
2 SASI_Mm01_00196270 predicted 916
3 SASI_Mm01_00196271 predicted 927
4 SASI_Mm01_00196274 predicted 541
5 SASI_Mm01_00196275 predicted 441
6 SASI_Mm01_00196276 predicted 597
7 SASI_Mm02_00338063 predicted 961
8 SASI_Mm02_00338064 predicted 398
9 SASI_Mm02_00338065 predicted 485
10 SASI_Mm02_00338066 predicted 540
11 SASI_Mm01_00196272 predicted 282
12 SASI_Mm01_00196273 predicted 957
13 SASI_Mm01_00196277 predicted 967
14 SASI_Mm01_00196278 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012074
VALIDATED
DPF3 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers, family 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012074.1-1072s1c1
Sequence:CCGGGCAGGCTGTTACTGGCTAAATCTCGAGATTTAGCCAGTAACAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-588s1c1
Sequence:CCGGCCGTGATAGATGCTAAGGAGTCTCGAGACTCCTTAGCATCTATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012074.1-247s1c1
Sequence:CCGGCTGGCGCAAGAAGAGACGATTCTCGAGAATCGTCTCTTCTTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-85s1c1
Sequence:CCGGCCGGAGTTACAACTCACGGCTCTCGAGAGCCGTGAGTTGTAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-499s1c1
Sequence:CCGGAGAGGATATTCCCAAGCGAAACTCGAGTTTCGCTTGGGAATATCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-248s21c1
Sequence:CCGGTGGCGCAAGAAGAGACGATTGCTCGAGCAATCGTCTCTTCTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-992s21c1
Sequence:CCGGGGCTTTGATGAGGACGATTTGCTCGAGCAAATCGTCCTCATCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012074.3-1335s21c1
Sequence:CCGGGGCATCGTGATGCGCTATTTACTCGAGTAAATAGCGCATCACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-1052s21c1
Sequence:CCGGGGTTCGCCCACAGCAGATAAACTCGAGTTTATCTGCTGTGGGCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-934s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012074
VALIDATED
DPF3 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers, family 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012074.1-1072s1c1
Sequence:CCGGGCAGGCTGTTACTGGCTAAATCTCGAGATTTAGCCAGTAACAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-588s1c1
Sequence:CCGGCCGTGATAGATGCTAAGGAGTCTCGAGACTCCTTAGCATCTATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012074.1-247s1c1
Sequence:CCGGCTGGCGCAAGAAGAGACGATTCTCGAGAATCGTCTCTTCTTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-85s1c1
Sequence:CCGGCCGGAGTTACAACTCACGGCTCTCGAGAGCCGTGAGTTGTAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-499s1c1
Sequence:CCGGAGAGGATATTCCCAAGCGAAACTCGAGTTTCGCTTGGGAATATCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-248s21c1
Sequence:CCGGTGGCGCAAGAAGAGACGATTGCTCGAGCAATCGTCTCTTCTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-992s21c1
Sequence:CCGGGGCTTTGATGAGGACGATTTGCTCGAGCAAATCGTCCTCATCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012074.3-1335s21c1
Sequence:CCGGGGCATCGTGATGCGCTATTTACTCGAGTAAATAGCGCATCACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-1052s21c1
Sequence:CCGGGGTTCGCCCACAGCAGATAAACTCGAGTTTATCTGCTGTGGGCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-934s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012074
VALIDATED
DPF3 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers, family 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012074.1-1072s1c1
Sequence:CCGGGCAGGCTGTTACTGGCTAAATCTCGAGATTTAGCCAGTAACAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-588s1c1
Sequence:CCGGCCGTGATAGATGCTAAGGAGTCTCGAGACTCCTTAGCATCTATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012074.1-247s1c1
Sequence:CCGGCTGGCGCAAGAAGAGACGATTCTCGAGAATCGTCTCTTCTTGCGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-85s1c1
Sequence:CCGGCCGGAGTTACAACTCACGGCTCTCGAGAGCCGTGAGTTGTAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012074.1-499s1c1
Sequence:CCGGAGAGGATATTCCCAAGCGAAACTCGAGTTTCGCTTGGGAATATCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-248s21c1
Sequence:CCGGTGGCGCAAGAAGAGACGATTGCTCGAGCAATCGTCTCTTCTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-992s21c1
Sequence:CCGGGGCTTTGATGAGGACGATTTGCTCGAGCAAATCGTCCTCATCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012074.3-1335s21c1
Sequence:CCGGGGCATCGTGATGCGCTATTTACTCGAGTAAATAGCGCATCACGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-1052s21c1
Sequence:CCGGGGTTCGCCCACAGCAGATAAACTCGAGTTTATCTGCTGTGGGCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012074.3-934s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058212
DPF3 MISSION shRNA Bacterial Glycerol Stock
D4, zinc and double PHD fingers, family 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-286s1c1
Sequence:CCGGCTGGAAATCAAACCCGTAGAACTCGAGTTCTACGGGTTTGATTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-759s1c1
Sequence:CCGGGACAGTCATTCCTAATAACTACTCGAGTAGTTATTAGGAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058212.1-1123s1c1
Sequence:CCGGGTCATTGTTCTAGTTCTGATACTCGAGTATCAGAACTAGAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-756s1c1
Sequence:CCGGCGGGACAGTCATTCCTAATAACTCGAGTTATTAGGAATGACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-975s1c1
Sequence:CCGGCGGCTTTGATGAGGACGATTTCTCGAGAAATCGTCCTCATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-918s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-600s21c1
Sequence:CCGGCATCTGTGGCAAGCGCTACAACTCGAGTTGTAGCGCTTGCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-486s21c1
Sequence:CCGGAGATGTTCCCAAGCGCAAGAACTCGAGTTCTTGCGCTTGGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058212
DPF3 MISSION shRNA shRNA Plasmid DNA
D4, zinc and double PHD fingers, family 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-286s1c1
Sequence:CCGGCTGGAAATCAAACCCGTAGAACTCGAGTTCTACGGGTTTGATTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-759s1c1
Sequence:CCGGGACAGTCATTCCTAATAACTACTCGAGTAGTTATTAGGAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058212.1-1123s1c1
Sequence:CCGGGTCATTGTTCTAGTTCTGATACTCGAGTATCAGAACTAGAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-756s1c1
Sequence:CCGGCGGGACAGTCATTCCTAATAACTCGAGTTATTAGGAATGACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-975s1c1
Sequence:CCGGCGGCTTTGATGAGGACGATTTCTCGAGAAATCGTCCTCATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-918s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-600s21c1
Sequence:CCGGCATCTGTGGCAAGCGCTACAACTCGAGTTGTAGCGCTTGCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-486s21c1
Sequence:CCGGAGATGTTCCCAAGCGCAAGAACTCGAGTTCTTGCGCTTGGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058212
DPF3 MISSION shRNA Lentiviral Transduction Particles
D4, zinc and double PHD fingers, family 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-286s1c1
Sequence:CCGGCTGGAAATCAAACCCGTAGAACTCGAGTTCTACGGGTTTGATTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-759s1c1
Sequence:CCGGGACAGTCATTCCTAATAACTACTCGAGTAGTTATTAGGAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058212.1-1123s1c1
Sequence:CCGGGTCATTGTTCTAGTTCTGATACTCGAGTATCAGAACTAGAACAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-756s1c1
Sequence:CCGGCGGGACAGTCATTCCTAATAACTCGAGTTATTAGGAATGACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058212.1-975s1c1
Sequence:CCGGCGGCTTTGATGAGGACGATTTCTCGAGAAATCGTCCTCATCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-918s21c1
Sequence:CCGGACGTACCACGGAGGACTTATTCTCGAGAATAAGTCCTCCGTGGTACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-600s21c1
Sequence:CCGGCATCTGTGGCAAGCGCTACAACTCGAGTTGTAGCGCTTGCCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058212.1-486s21c1
Sequence:CCGGAGATGTTCCCAAGCGCAAGAACTCGAGTTCTTGCGCTTGGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks