EMAIL THIS PAGE TO A FRIEND

DPH1

diphthamide biosynthesis 1

133 Gene Product Result for
Synonyms: DPH2L DPH2L1 OVCA1
UniProtKB ID: Q9BZG8, D3DTI3, Q16439, Q4VBA2, Q9BTW7, Q9UCY0
Gene ID:
Human(1801) Summary: Diphthamide is a unique posttranslationally modified histidine found only in translation elongation factor-2 (EEF2; MIM 130610). This modification is conserved from archaebacteria to humans and serves as the target for ADP-ribosylation and inactivation of EEF2 by diphtheria toxin (DT) and Pseudomonas exotoxin A. DPH1 is 1 of several enzymes involved in synthesis of diphthamide in EEF2 (Liu et al., 2004 [PubMed 15485916]
Mouse(116905) DPH1 homolog (S. cerevisiae)
Rat(287523) DPH1 homolog (S. cerevisiae)
Zebrafish(550559) DPH1 homolog (S. cerevisiae)
chicken(417564) DPH1 homolog (S. cerevisiae)
domestic cat(101083810) DPH1 homolog (S. cerevisiae)
Horse(100060117) DPH1 homolog (S. cerevisiae)
dog(480653) DPH1 homolog (S. cerevisiae)
cow(534099) DPH1 homolog (S. cerevisiae)
naked mole-rat(101700222) diphthamide biosynthesis 1
domestic guinea pig(100715978) diphthamide biosynthesis 1
sheep(101104511) DPH1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001383 Rosetta Predictions human pricing
NM_001105809 Rosetta Predictions rat pricing
NM_144491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217033 predicted 1781
2 SASI_Hs01_00217034 predicted 1676
3 SASI_Hs01_00217035 predicted 1744
4 SASI_Hs01_00217036 predicted 1603
5 SASI_Hs02_00331743 predicted 1732
6 SASI_Hs01_00217038 predicted 1605
7 SASI_Hs01_00217040 predicted 1602
8 SASI_Hs01_00217041 predicted 1674
9 SASI_Hs01_00217037 predicted 1669
10 SASI_Hs02_00331744 predicted 1758
11 SASI_Hs01_00217039 predicted 1701
12 SASI_Hs01_00217042 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212746 predicted 911
2 SASI_Rn02_00212747 predicted 450
3 SASI_Rn02_00212748 predicted 465
4 SASI_Rn02_00212749 predicted 532
5 SASI_Rn02_00212750 predicted 768
6 SASI_Rn02_00212751 predicted 243
7 SASI_Rn02_00212752 predicted 588
8 SASI_Rn02_00212753 predicted 208
9 SASI_Rn02_00212754 predicted 264
10 SASI_Rn02_00212755 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094654 predicted 784
2 SASI_Mm02_00340025 predicted 259
3 SASI_Mm01_00094655 predicted 220
4 SASI_Mm01_00094656 predicted 471
5 SASI_Mm01_00094657 predicted 770
6 SASI_Mm01_00094658 predicted 871
7 SASI_Mm01_00094660 predicted 602
8 SASI_Mm01_00094661 predicted 276
9 SASI_Mm01_00094662 predicted 395
10 SASI_Mm02_00340026 predicted 774
11 SASI_Mm01_00094653 predicted 379
12 SASI_Mm01_00094659 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144491
VALIDATED
DPH1 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-794s21c1
Sequence:CCGGTCCTATCCAGAGAATACTATGCTCGAGCATAGTATTCTCTGGATAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-459s21c1
Sequence:CCGGCTTGTATGTCTTCGTGGATATCTCGAGATATCCACGAAGACATACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-1115s21c1
Sequence:CCGGCTGTGGCCCTGAAGGACATTTCTCGAGAAATGTCCTTCAGGGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-273s21c1
Sequence:CCGGTGCCTGCACTATTGTGGATATCTCGAGATATCCACAATAGTGCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-748s21c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-740s1c1
Sequence:CCGGCCAACCCTAATATACCTGCTTCTCGAGAAGCAGGTATATTAGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144491.1-1835s1c1
Sequence:CCGGGCAGAATGAAGGATGGACAAACTCGAGTTTGTCCATCCTTCATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-448s1c1
Sequence:CCGGGTCTTGTATGTCTTCGTGGATCTCGAGATCCACGAAGACATACAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-229s1c1
Sequence:CCGGGTGGCCTTACAAATGCCAGAACTCGAGTTCTGGCATTTGTAAGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-739s1c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144491
VALIDATED
DPH1 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-794s21c1
Sequence:CCGGTCCTATCCAGAGAATACTATGCTCGAGCATAGTATTCTCTGGATAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-459s21c1
Sequence:CCGGCTTGTATGTCTTCGTGGATATCTCGAGATATCCACGAAGACATACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-1115s21c1
Sequence:CCGGCTGTGGCCCTGAAGGACATTTCTCGAGAAATGTCCTTCAGGGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-273s21c1
Sequence:CCGGTGCCTGCACTATTGTGGATATCTCGAGATATCCACAATAGTGCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-748s21c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-740s1c1
Sequence:CCGGCCAACCCTAATATACCTGCTTCTCGAGAAGCAGGTATATTAGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144491.1-1835s1c1
Sequence:CCGGGCAGAATGAAGGATGGACAAACTCGAGTTTGTCCATCCTTCATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-448s1c1
Sequence:CCGGGTCTTGTATGTCTTCGTGGATCTCGAGATCCACGAAGACATACAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-229s1c1
Sequence:CCGGGTGGCCTTACAAATGCCAGAACTCGAGTTCTGGCATTTGTAAGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-739s1c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144491
VALIDATED
DPH1 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-794s21c1
Sequence:CCGGTCCTATCCAGAGAATACTATGCTCGAGCATAGTATTCTCTGGATAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-459s21c1
Sequence:CCGGCTTGTATGTCTTCGTGGATATCTCGAGATATCCACGAAGACATACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-1115s21c1
Sequence:CCGGCTGTGGCCCTGAAGGACATTTCTCGAGAAATGTCCTTCAGGGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-273s21c1
Sequence:CCGGTGCCTGCACTATTGTGGATATCTCGAGATATCCACAATAGTGCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144491.2-748s21c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-740s1c1
Sequence:CCGGCCAACCCTAATATACCTGCTTCTCGAGAAGCAGGTATATTAGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144491.1-1835s1c1
Sequence:CCGGGCAGAATGAAGGATGGACAAACTCGAGTTTGTCCATCCTTCATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-448s1c1
Sequence:CCGGGTCTTGTATGTCTTCGTGGATCTCGAGATCCACGAAGACATACAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144491.1-229s1c1
Sequence:CCGGGTGGCCTTACAAATGCCAGAACTCGAGTTCTGGCATTTGTAAGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144491.1-739s1c1
Sequence:CCGGGCCAACCCTAATATACCTGCTCTCGAGAGCAGGTATATTAGGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001383
VALIDATED
DPH1 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-775s21c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-706s21c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-492s21c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-732s21c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-826s1c1
Sequence:CCGGCATATAGCAAAGTCCTATCCACTCGAGTGGATAGGACTTTGCTATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-503s1c1
Sequence:CCGGGCTGTACGTCTTTGTGGACATCTCGAGATGTCCACAAAGACGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-598s1c1
Sequence:CCGGGCACCATTCAGTTTGTGTCGACTCGAGTCGACACAAACTGAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-527s1c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-767s1c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-591s1c1
Sequence:CCGGCTGGTCAGCACCATTCAGTTTCTCGAGAAACTGAATGGTGCTGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-601s1c1
Sequence:CCGGCCATTCAGTTTGTGTCGACCTCTCGAGAGGTCGACACAAACTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-519s1c1
Sequence:CCGGGACATCCGGATAGACACTACACTCGAGTGTAGTGTCTATCCGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-741s1c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001383.1-810s1c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001383.2-1905s1c1
Sequence:CCGGGAAATGTCTCTGCTCCTACATCTCGAGATGTAGGAGCAGAGACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001383
VALIDATED
DPH1 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-775s21c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-706s21c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-492s21c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-732s21c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-826s1c1
Sequence:CCGGCATATAGCAAAGTCCTATCCACTCGAGTGGATAGGACTTTGCTATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-503s1c1
Sequence:CCGGGCTGTACGTCTTTGTGGACATCTCGAGATGTCCACAAAGACGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-598s1c1
Sequence:CCGGGCACCATTCAGTTTGTGTCGACTCGAGTCGACACAAACTGAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-527s1c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-767s1c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-591s1c1
Sequence:CCGGCTGGTCAGCACCATTCAGTTTCTCGAGAAACTGAATGGTGCTGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-601s1c1
Sequence:CCGGCCATTCAGTTTGTGTCGACCTCTCGAGAGGTCGACACAAACTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-519s1c1
Sequence:CCGGGACATCCGGATAGACACTACACTCGAGTGTAGTGTCTATCCGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-741s1c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001383.1-810s1c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001383.2-1905s1c1
Sequence:CCGGGAAATGTCTCTGCTCCTACATCTCGAGATGTAGGAGCAGAGACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001383
VALIDATED
DPH1 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-775s21c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-706s21c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-492s21c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001383.3-732s21c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-826s1c1
Sequence:CCGGCATATAGCAAAGTCCTATCCACTCGAGTGGATAGGACTTTGCTATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-503s1c1
Sequence:CCGGGCTGTACGTCTTTGTGGACATCTCGAGATGTCCACAAAGACGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-598s1c1
Sequence:CCGGGCACCATTCAGTTTGTGTCGACTCGAGTCGACACAAACTGAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-527s1c1
Sequence:CCGGGATAGACACTACACACCTCCTCTCGAGAGGAGGTGTGTAGTGTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001383.1-767s1c1
Sequence:CCGGCTTCCATCTGGAGTCTGTCATCTCGAGATGACAGACTCCAGATGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-591s1c1
Sequence:CCGGCTGGTCAGCACCATTCAGTTTCTCGAGAAACTGAATGGTGCTGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-601s1c1
Sequence:CCGGCCATTCAGTTTGTGTCGACCTCTCGAGAGGTCGACACAAACTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001383.1-519s1c1
Sequence:CCGGGACATCCGGATAGACACTACACTCGAGTGTAGTGTCTATCCGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001383.1-741s1c1
Sequence:CCGGGCCGTTGTGTATCTTGGAGATCTCGAGATCTCCAAGATACACAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001383.1-810s1c1
Sequence:CCGGGCTTACCGGTATGACCCATATCTCGAGATATGGGTCATACCGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001383.2-1905s1c1
Sequence:CCGGGAAATGTCTCTGCTCCTACATCTCGAGATGTAGGAGCAGAGACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)