EMAIL THIS PAGE TO A FRIEND

DPH2

DPH2 homolog (S. cerevisiae)

Synonyms: DPH2L2
UniProtKB ID: Q9BQC3, A8MVC9, B2RDE3, O60623
Gene ID:
Human(1802) Summary: This gene is one of two human genes similar to the yeast gene dph2. The yeast gene was identified by its ability to complement a diphthamide mutant strain, and thus probably functions in diphthamide biosynthesis. Diphthamide is a post-translationally modified histidine residue present in elongation factor 2 (EF2) that is the target of diphtheria toxin ADP-ribosylation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67728) DPH2 homolog (S. cerevisiae)
Rat(298452) DPH2 homolog (S. cerevisiae)
sheep(101113967) DPH2 homolog (S. cerevisiae)
Domestic Rabbit(100351922) DPH2 homolog (S. cerevisiae)
domestic guinea pig(100720011) DPH2 homolog (S. cerevisiae)
naked mole-rat(101717886) DPH2 homolog (S. cerevisiae)
Zebrafish(562538) DPH2 homolog (S. cerevisiae)
chicken(424574) DPH2 homolog (S. cerevisiae)
domestic cat(101084123) DPH2 homolog (S. cerevisiae)
cow(768224) DPH2 homolog (S. cerevisiae)
dog(475387) DPH2 homolog (S. cerevisiae)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039589 Rosetta Predictions human pricing
NM_001384 Rosetta Predictions human pricing
NM_001015007 Rosetta Predictions rat pricing
NM_026344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224333 predicted 911
2 SASI_Hs01_00224334 predicted 940
3 SASI_Hs01_00224336 predicted 358
4 SASI_Hs01_00224337 predicted 396
5 SASI_Hs01_00224338 predicted 989
6 SASI_Hs01_00224339 predicted 1109
7 SASI_Hs01_00224340 predicted 945
8 SASI_Hs01_00224342 predicted 935
9 SASI_Hs02_00308593 predicted 914
10 SASI_Hs02_00308594 predicted 331
11 SASI_Hs01_00224335 predicted 412
12 SASI_Hs01_00224341 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137651 predicted 1598
2 SASI_Hs01_00137652 predicted 1623
3 SASI_Hs01_00137654 predicted 353
4 SASI_Hs01_00137655 predicted 396
5 SASI_Hs01_00137656 predicted 1682
6 SASI_Hs01_00137657 predicted 1793
7 SASI_Hs01_00137658 predicted 1628
8 SASI_Hs01_00137660 predicted 1627
9 SASI_Hs02_00331745 predicted 1596
10 SASI_Hs02_00331746 predicted 330
11 SASI_Hs01_00137653 predicted 419
12 SASI_Hs01_00137659 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201941 predicted 199
2 SASI_Rn02_00201942 predicted 1365
3 SASI_Rn02_00201943 predicted 879
4 SASI_Rn02_00201944 predicted 1630
5 SASI_Rn02_00201945 predicted 1094
6 SASI_Rn02_00201946 predicted 1223
7 SASI_Rn02_00201947 predicted 949
8 SASI_Rn02_00201948 predicted 1090
9 SASI_Rn02_00201949 predicted 290
10 SASI_Rn02_00201950 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189146 predicted 1694
2 SASI_Mm02_00330060 predicted 275
3 SASI_Mm01_00189148 predicted 1005
4 SASI_Mm01_00189149 predicted 1567
5 SASI_Mm01_00189150 predicted 1413
6 SASI_Mm01_00189151 predicted 1148
7 SASI_Mm01_00189152 predicted 1425
8 SASI_Mm01_00189153 predicted 1084
9 SASI_Mm02_00330061 predicted 1138
10 SASI_Mm01_00189154 predicted 256
11 SASI_Mm01_00189147 predicted 1618
12 SASI_Mm01_00189155 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001384
VALIDATED
DPH2 MISSION shRNA Bacterial Glycerol Stock
DPH2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-1192s1c1
Sequence:CCGGGTCTTTGTGCTATTAGCCTGTCTCGAGACAGGCTAATAGCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-826s1c1
Sequence:CCGGGAGTATGGTGCCTTCTATGTACTCGAGTACATAGAAGGCACCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1330s1c1
Sequence:CCGGCTCACACATTATGCGGACTTACTCGAGTAAGTCCGCATAATGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1416s1c1
Sequence:CCGGCGTGTCACTCATTACTGGAGACTCGAGTCTCCAGTAATGAGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1233s1c1
Sequence:CCGGCCAGCTTTCTGGTAGCTTCTTCTCGAGAAGAAGCTACCAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001384.3-1411s1c1
Sequence:CCGGCCAGACGTGTCACTCATTACTCTCGAGAGTAATGAGTGACACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-405s1c1
Sequence:CCGGGACAGGGTCAAAGATGTTCATCTCGAGATGAACATCTTTGACCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1186s1c1
Sequence:CCGGGTGGATGTCTTTGTGCTATTACTCGAGTAATAGCACAAAGACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.4-1700s1c1
Sequence:CCGGGAATGGCTGCTAGGACCTTTACTCGAGTAAAGGTCCTAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001384
VALIDATED
DPH2 MISSION shRNA shRNA Plasmid DNA
DPH2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-1192s1c1
Sequence:CCGGGTCTTTGTGCTATTAGCCTGTCTCGAGACAGGCTAATAGCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-826s1c1
Sequence:CCGGGAGTATGGTGCCTTCTATGTACTCGAGTACATAGAAGGCACCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1330s1c1
Sequence:CCGGCTCACACATTATGCGGACTTACTCGAGTAAGTCCGCATAATGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1416s1c1
Sequence:CCGGCGTGTCACTCATTACTGGAGACTCGAGTCTCCAGTAATGAGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1233s1c1
Sequence:CCGGCCAGCTTTCTGGTAGCTTCTTCTCGAGAAGAAGCTACCAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001384.3-1411s1c1
Sequence:CCGGCCAGACGTGTCACTCATTACTCTCGAGAGTAATGAGTGACACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-405s1c1
Sequence:CCGGGACAGGGTCAAAGATGTTCATCTCGAGATGAACATCTTTGACCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1186s1c1
Sequence:CCGGGTGGATGTCTTTGTGCTATTACTCGAGTAATAGCACAAAGACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.4-1700s1c1
Sequence:CCGGGAATGGCTGCTAGGACCTTTACTCGAGTAAAGGTCCTAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001384
VALIDATED
DPH2 MISSION shRNA Lentiviral Transduction Particles
DPH2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-1192s1c1
Sequence:CCGGGTCTTTGTGCTATTAGCCTGTCTCGAGACAGGCTAATAGCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.3-826s1c1
Sequence:CCGGGAGTATGGTGCCTTCTATGTACTCGAGTACATAGAAGGCACCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1330s1c1
Sequence:CCGGCTCACACATTATGCGGACTTACTCGAGTAAGTCCGCATAATGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1416s1c1
Sequence:CCGGCGTGTCACTCATTACTGGAGACTCGAGTCTCCAGTAATGAGTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1233s1c1
Sequence:CCGGCCAGCTTTCTGGTAGCTTCTTCTCGAGAAGAAGCTACCAGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001384.3-1411s1c1
Sequence:CCGGCCAGACGTGTCACTCATTACTCTCGAGAGTAATGAGTGACACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-405s1c1
Sequence:CCGGGACAGGGTCAAAGATGTTCATCTCGAGATGAACATCTTTGACCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001384.3-1186s1c1
Sequence:CCGGGTGGATGTCTTTGTGCTATTACTCGAGTAATAGCACAAAGACATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001384.4-1700s1c1
Sequence:CCGGGAATGGCTGCTAGGACCTTTACTCGAGTAAAGGTCCTAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026344
VALIDATED
DPH2 MISSION shRNA Bacterial Glycerol Stock
DPH2 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026344.2-1999s1c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-1217s1c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1432s1c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-311s1c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-262s21c1
Sequence:CCGGACGAAATTTGTCTGCGATTTACTCGAGTAAATCGCAGACAAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1431s21c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1998s21c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1429s1c2
Sequence:CCGGTGACACTAGATGTTCGGCCTTCTCGAGAAGGCCGAACATCTAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1216s21c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-310s21c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026344
VALIDATED
DPH2 MISSION shRNA shRNA Plasmid DNA
DPH2 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026344.2-1999s1c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-1217s1c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1432s1c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-311s1c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-262s21c1
Sequence:CCGGACGAAATTTGTCTGCGATTTACTCGAGTAAATCGCAGACAAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1431s21c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1998s21c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1429s1c2
Sequence:CCGGTGACACTAGATGTTCGGCCTTCTCGAGAAGGCCGAACATCTAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1216s21c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-310s21c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026344
VALIDATED
DPH2 MISSION shRNA Lentiviral Transduction Particles
DPH2 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026344.2-1999s1c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-1217s1c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1432s1c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026344.2-311s1c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-262s21c1
Sequence:CCGGACGAAATTTGTCTGCGATTTACTCGAGTAAATCGCAGACAAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1431s21c1
Sequence:CCGGCACTAGATGTTCGGCCTTAATCTCGAGATTAAGGCCGAACATCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1998s21c1
Sequence:CCGGCCCAGATTATCTCTACAGGTTCTCGAGAACCTGTAGAGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026344.2-1429s1c2
Sequence:CCGGTGACACTAGATGTTCGGCCTTCTCGAGAAGGCCGAACATCTAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-1216s21c1
Sequence:CCGGCCTGTATTGACGCCATGTGAACTCGAGTTCACATGGCGTCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026344.3-310s21c1
Sequence:CCGGCCTGACCAGTTACTAGGAGATCTCGAGATCTCCTAGTAACTGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks