EMAIL THIS PAGE TO A FRIEND

DPH3

diphthamide biosynthesis 3

69 Gene Product Result for
Synonyms: DELGIP DELGIP1 DESR1 DPH3A KTI11 ZCSL2
UniProtKB ID: Q96FX2
Gene ID:
Human(285381) Summary: This gene encodes a CSL zinc finger-containing protein that is required for dipthamide biosynthesis. The encoded protein is necessary for the initial step in the modification of a histidine residue in elongation factor-2 to diphthamide. This modified residue is a target for ADP ribosylation by the bacterial toxins diphtheria toxin and Pseudomonas exotoxin A. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Feb 2009]
Mouse(105638) diphthamine biosynthesis 3
Rat(680594) diphthamide biosynthesis 3
Zebrafish(553692) diphthamide biosynthesis 3
chicken(420643) DPH3, KTI11 homolog (S. cerevisiae)
cow(511579) DPH3, KTI11 homolog (S. cerevisiae)
domestic cat(101097089) DPH3, KTI11 homolog (S. cerevisiae)
dog(610533) DPH3, KTI11 homolog (S. cerevisiae)
naked mole-rat(101720523) DPH3, KTI11 homolog (S. cerevisiae)
domestic guinea pig(100725710) diphthamide biosynthesis 3
sheep(101120039) DPH3, KTI11 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035287 Anti-DPH3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001047434 Rosetta Predictions human pricing
NM_206831 Rosetta Predictions human pricing
NM_001134850 Rosetta Predictions rat pricing
NM_001047433 Rosetta Predictions mouse pricing
NM_172254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311497 predicted 274
2 SASI_Hs02_00311498 predicted 309
3 SASI_Hs02_00311499 predicted 354
4 SASI_Hs02_00311500 predicted 303
5 SASI_Hs02_00311501 predicted 338
6 SASI_Hs02_00311502 predicted 248
7 SASI_Hs02_00311503 predicted 315
8 SASI_Hs02_00311504 predicted 343
9 SASI_Hs02_00311505 predicted 194
10 SASI_Hs02_00311506 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083210 predicted 263
2 SASI_Hs01_00083211 predicted 301
3 SASI_Hs01_00083212 predicted 303
4 SASI_Hs01_00083213 predicted 235
5 SASI_Hs01_00083214 predicted 305
6 SASI_Hs02_00373556 predicted 290
7 SASI_Hs01_00083218 predicted 247
8 SASI_Hs01_00083219 predicted 265
9 SASI_Hs02_00373557 predicted 274
10 SASI_Hs02_00373558 predicted 309
11 SASI_Hs01_00083215 predicted 269
12 SASI_Hs01_00083216 predicted 244
13 SASI_Hs01_00083217 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258744 predicted 229
2 SASI_Rn02_00258745 predicted 591
3 SASI_Rn02_00258746 predicted 539
4 SASI_Rn02_00258747 predicted 232
5 SASI_Rn02_00258748 predicted 508
6 SASI_Rn02_00258749 predicted 768
7 SASI_Rn02_00258750 predicted 404
8 SASI_Rn02_00258751 predicted 748
9 SASI_Rn02_00258752 predicted 657
10 SASI_Rn02_00258753 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291901 predicted 200
2 SASI_Mm02_00291902 predicted 300
3 SASI_Mm02_00291903 predicted 522
4 SASI_Mm02_00291904 predicted 421
5 SASI_Mm02_00291905 predicted 165
6 SASI_Mm02_00291906 predicted 562
7 SASI_Mm02_00291907 predicted 283
8 SASI_Mm02_00291908 predicted 299
9 SASI_Mm02_00291909 predicted 795
10 SASI_Mm02_00291910 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187532 predicted 197
2 SASI_Mm01_00187533 predicted 377
3 SASI_Mm01_00187534 predicted 595
4 SASI_Mm01_00187535 predicted 489
5 SASI_Mm01_00187536 predicted 172
6 SASI_Mm01_00187537 predicted 630
7 SASI_Mm01_00187538 predicted 359
8 SASI_Mm01_00187539 predicted 371
9 SASI_Mm01_00187540 predicted 288
10 SASI_Mm01_00187541 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206831
DPH3 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-471s21c1
Sequence:CCGGTGTAAGAGTGTGGATTCTTTCCTCGAGGAAAGAATCCACACTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-791s21c1
Sequence:CCGGCATCAGCTTTGCTGTTCTAAACTCGAGTTTAGAACAGCAAAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206831.2-240s21c1
Sequence:CCGGGAAGACGTGGCAACGTGTCCTCTCGAGAGGACACGTTGCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-200s1c1
Sequence:CCGGGACAAAGATCAGTTTGTGTGTCTCGAGACACACAAACTGATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-167s1c1
Sequence:CCGGCCTAGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-168s1c1
Sequence:CCGGCTAGCTGCTCTCTCATTATAACTCGAGTTATAATGAGAGAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206831.1-312s1c1
Sequence:CCGGGCCCAGATAGAAATATCGAATCTCGAGATTCGATATTTCTATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206831.1-206s1c1
Sequence:CCGGGATCAGTTTGTGTGTGGAGAACTCGAGTTCTCCACACACAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-105s1c1
Sequence:CCGGGTGGAGATAACTTCTCCATCACTCGAGTGATGGAGAAGTTATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206831
DPH3 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-471s21c1
Sequence:CCGGTGTAAGAGTGTGGATTCTTTCCTCGAGGAAAGAATCCACACTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-791s21c1
Sequence:CCGGCATCAGCTTTGCTGTTCTAAACTCGAGTTTAGAACAGCAAAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206831.2-240s21c1
Sequence:CCGGGAAGACGTGGCAACGTGTCCTCTCGAGAGGACACGTTGCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-200s1c1
Sequence:CCGGGACAAAGATCAGTTTGTGTGTCTCGAGACACACAAACTGATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-167s1c1
Sequence:CCGGCCTAGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-168s1c1
Sequence:CCGGCTAGCTGCTCTCTCATTATAACTCGAGTTATAATGAGAGAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206831.1-312s1c1
Sequence:CCGGGCCCAGATAGAAATATCGAATCTCGAGATTCGATATTTCTATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206831.1-206s1c1
Sequence:CCGGGATCAGTTTGTGTGTGGAGAACTCGAGTTCTCCACACACAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-105s1c1
Sequence:CCGGGTGGAGATAACTTCTCCATCACTCGAGTGATGGAGAAGTTATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206831
DPH3 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-471s21c1
Sequence:CCGGTGTAAGAGTGTGGATTCTTTCCTCGAGGAAAGAATCCACACTCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206831.2-791s21c1
Sequence:CCGGCATCAGCTTTGCTGTTCTAAACTCGAGTTTAGAACAGCAAAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206831.2-240s21c1
Sequence:CCGGGAAGACGTGGCAACGTGTCCTCTCGAGAGGACACGTTGCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-200s1c1
Sequence:CCGGGACAAAGATCAGTTTGTGTGTCTCGAGACACACAAACTGATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-167s1c1
Sequence:CCGGCCTAGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-168s1c1
Sequence:CCGGCTAGCTGCTCTCTCATTATAACTCGAGTTATAATGAGAGAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206831.1-312s1c1
Sequence:CCGGGCCCAGATAGAAATATCGAATCTCGAGATTCGATATTTCTATCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206831.1-206s1c1
Sequence:CCGGGATCAGTTTGTGTGTGGAGAACTCGAGTTCTCCACACACAAACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206831.1-105s1c1
Sequence:CCGGGTGGAGATAACTTCTCCATCACTCGAGTGATGGAGAAGTTATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172254
VALIDATED
DPH3 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-291s21c1
Sequence:CCGGGTCCTAGCTGCTCACTCATTACTCGAGTAATGAGTGAGCAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172254.3-1239s1c1
Sequence:CCGGCTTATGTCAGGACAGGTTAAACTCGAGTTTAACCTGTCCTGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.3-380s1c1
Sequence:CCGGGAGTTAGTTAAATGCTGAAGACTCGAGTCTTCAGCATTTAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-372s21c1
Sequence:CCGGCCAACAAGGAGTTAGTTAAATCTCGAGATTTAACTAACTCCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172254.3-2749s21c1
Sequence:CCGGCTATGAGTGGACGCTTCATTTCTCGAGAAATGAAGCGTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-236s21c1
Sequence:CCGGGATAACTTTGCCATCACCAAGCTCGAGCTTGGTGATGGCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-196s21c1
Sequence:CCGGCGAGGACTCGGAGACATATTTCTCGAGAAATATGTCTCCGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.2-282s1c1
Sequence:CCGGCCTTCAACCAACAAGGAGTTACTCGAGTAACTCCTTGTTGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172254
VALIDATED
DPH3 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-291s21c1
Sequence:CCGGGTCCTAGCTGCTCACTCATTACTCGAGTAATGAGTGAGCAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172254.3-1239s1c1
Sequence:CCGGCTTATGTCAGGACAGGTTAAACTCGAGTTTAACCTGTCCTGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.3-380s1c1
Sequence:CCGGGAGTTAGTTAAATGCTGAAGACTCGAGTCTTCAGCATTTAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-372s21c1
Sequence:CCGGCCAACAAGGAGTTAGTTAAATCTCGAGATTTAACTAACTCCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172254.3-2749s21c1
Sequence:CCGGCTATGAGTGGACGCTTCATTTCTCGAGAAATGAAGCGTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-236s21c1
Sequence:CCGGGATAACTTTGCCATCACCAAGCTCGAGCTTGGTGATGGCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-196s21c1
Sequence:CCGGCGAGGACTCGGAGACATATTTCTCGAGAAATATGTCTCCGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.2-282s1c1
Sequence:CCGGCCTTCAACCAACAAGGAGTTACTCGAGTAACTCCTTGTTGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172254
VALIDATED
DPH3 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-291s21c1
Sequence:CCGGGTCCTAGCTGCTCACTCATTACTCGAGTAATGAGTGAGCAGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217222    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172254.3-1239s1c1
Sequence:CCGGCTTATGTCAGGACAGGTTAAACTCGAGTTTAACCTGTCCTGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.3-380s1c1
Sequence:CCGGGAGTTAGTTAAATGCTGAAGACTCGAGTCTTCAGCATTTAACTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-372s21c1
Sequence:CCGGCCAACAAGGAGTTAGTTAAATCTCGAGATTTAACTAACTCCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172254.3-2749s21c1
Sequence:CCGGCTATGAGTGGACGCTTCATTTCTCGAGAAATGAAGCGTCCACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-236s21c1
Sequence:CCGGGATAACTTTGCCATCACCAAGCTCGAGCTTGGTGATGGCAAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172254.3-196s21c1
Sequence:CCGGCGAGGACTCGGAGACATATTTCTCGAGAAATATGTCTCCGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172254.2-282s1c1
Sequence:CCGGCCTTCAACCAACAAGGAGTTACTCGAGTAACTCCTTGTTGGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks