EMAIL THIS PAGE TO A FRIEND

DPH3P1

diphthamide biosynthesis 3 pseudogene 1

32 Gene Product Result for
Synonyms: C20orf143 DPH3B ZCSL1 dJ885L7.5
Species: Human DPH3P1(100132911)
UniProtKB ID: Q9H4G8
Gene ID:
Human(100132911) Summary: This gene may represent a processed pseudogene of DPH3, GeneID: 285381, because it lacks the exon/intron structure found in the functional gene. However, it does contain an intact open reading frame and it has not been established that the predicted protein is not translated. The NCBI RefSeq Project continues to treat this as a protein coding gene in agreement with the HGNC and Swiss-Prot. [provided by RefSeq, Feb 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_039213 Rosetta Predictions human pricing
XR_039224 Rosetta Predictions human pricing
XR_039287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00509955 predicted 813
2 SASI_Hs02_00509956 predicted 648
3 SASI_Hs02_00509957 predicted 1283
4 SASI_Hs02_00509958 predicted 820
5 SASI_Hs02_00509959 predicted 1309
6 SASI_Hs02_00509960 predicted 1274
7 SASI_Hs02_00509961 predicted 642
8 SASI_Hs02_00509962 predicted 1231
9 SASI_Hs02_00509963 predicted 1259
10 SASI_Hs02_00509964 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510027 predicted 812
2 SASI_Hs02_00510028 predicted 652
3 SASI_Hs02_00510029 predicted 1282
4 SASI_Hs02_00510030 predicted 827
5 SASI_Hs02_00510031 predicted 1303
6 SASI_Hs02_00510032 predicted 1275
7 SASI_Hs02_00510033 predicted 642
8 SASI_Hs02_00510034 predicted 1223
9 SASI_Hs02_00510035 predicted 1259
10 SASI_Hs02_00510036 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510344 predicted 815
2 SASI_Hs02_00510345 predicted 652
3 SASI_Hs02_00510346 predicted 1281
4 SASI_Hs02_00510347 predicted 828
5 SASI_Hs02_00510348 predicted 1302
6 SASI_Hs02_00510349 predicted 1278
7 SASI_Hs02_00510350 predicted 644
8 SASI_Hs02_00510351 predicted 1225
9 SASI_Hs02_00510352 predicted 1256
10 SASI_Hs02_00510353 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080750
DPH3P1 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 3 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-752s21c1
Sequence:CCGGCAGTGCCTTCAGTCAACAAAGCTCGAGCTTTGTTGACTGAAGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-685s21c1
Sequence:CCGGCCAGGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080750.3-867s21c1
Sequence:CCGGTCGTGGAGACACAGCCATTTGCTCGAGCAAATGGCTGTGTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-592s21c1
Sequence:CCGGGACTCGGAGACATATTTCTGTCTCGAGACAGAAATATGTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-774s21c1
Sequence:CCGGATGAGTTAAATGCTAAGGAAGCTCGAGCTTCCTTAGCATTTAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080750
DPH3P1 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 3 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-752s21c1
Sequence:CCGGCAGTGCCTTCAGTCAACAAAGCTCGAGCTTTGTTGACTGAAGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-685s21c1
Sequence:CCGGCCAGGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080750.3-867s21c1
Sequence:CCGGTCGTGGAGACACAGCCATTTGCTCGAGCAAATGGCTGTGTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-592s21c1
Sequence:CCGGGACTCGGAGACATATTTCTGTCTCGAGACAGAAATATGTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-774s21c1
Sequence:CCGGATGAGTTAAATGCTAAGGAAGCTCGAGCTTCCTTAGCATTTAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080750
DPH3P1 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 3 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-752s21c1
Sequence:CCGGCAGTGCCTTCAGTCAACAAAGCTCGAGCTTTGTTGACTGAAGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-685s21c1
Sequence:CCGGCCAGGCTGCTCTCTCATTATACTCGAGTATAATGAGAGAGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080750.3-867s21c1
Sequence:CCGGTCGTGGAGACACAGCCATTTGCTCGAGCAAATGGCTGTGTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-592s21c1
Sequence:CCGGGACTCGGAGACATATTTCTGTCTCGAGACAGAAATATGTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080750.3-774s21c1
Sequence:CCGGATGAGTTAAATGCTAAGGAAGCTCGAGCTTCCTTAGCATTTAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks