EMAIL THIS PAGE TO A FRIEND

DPH5

diphthamide biosynthesis 5

73 Gene Product Result for
Synonyms: CGI-30 HSPC143 NPD015
UniProtKB ID: Q9H2P9, A8JZY6, D3DT62, Q9P017, Q9P0I4, Q9Y319
Gene ID:
Human(51611) Summary: This gene encodes a component of the diphthamide synthesis pathway. Diphthamide is a post-translationally modified histidine residue found only on translation elongation factor 2. It is conserved from archaebacteria to humans, and is targeted by diphtheria toxin and Pseudomonas exotoxin A to halt cellular protein synthesis. The yeast and Chinese hamster homologs of this protein catalyze the trimethylation of the histidine residue on elongation factor 2, resulting in a diphthine moiety that is subsequently amidated to yield diphthamide. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(69740) DPH5 homolog (S. cerevisiae)
Rat(295394) diphthamide biosynthesis 5
Zebrafish(492514) DPH5 homolog (S. cerevisiae)
cow(508904) DPH5 homolog (S. cerevisiae)
domestic cat(101090957) DPH5 homolog (S. cerevisiae)
dog(612092) DPH5 homolog (S. cerevisiae)
fruit fly(42663) Diphthamide methyltransferase
chicken(424463) DPH5 homolog (S. cerevisiae)
Zebrafish(100003898) DPH5 homolog (S. cerevisiae)
sheep(101115329) DPH5 homolog (S. cerevisiae)
domestic guinea pig(100732624) diphthamide biosynthesis 5
naked mole-rat(101696986) diphthamide biosynthesis 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015958 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077394 Rosetta Predictions human pricing
NM_001077395 Rosetta Predictions human pricing
NM_015958 Rosetta Predictions human pricing
NM_001017449 Rosetta Predictions rat pricing
NM_027193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312434 predicted 348
2 SASI_Hs02_00312435 predicted 460
3 SASI_Hs02_00312436 predicted 434
4 SASI_Hs02_00312437 predicted 460
5 SASI_Hs02_00312438 predicted 436
6 SASI_Hs02_00312439 predicted 425
7 SASI_Hs02_00312440 predicted 510
8 SASI_Hs02_00312441 predicted 473
9 SASI_Hs02_00312442 predicted 397
10 SASI_Hs02_00312443 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312444 predicted 325
2 SASI_Hs02_00312445 predicted 445
3 SASI_Hs02_00312446 predicted 415
4 SASI_Hs02_00312447 predicted 443
5 SASI_Hs02_00312448 predicted 422
6 SASI_Hs02_00312449 predicted 415
7 SASI_Hs02_00312450 predicted 490
8 SASI_Hs02_00312451 predicted 455
9 SASI_Hs02_00312452 predicted 377
10 SASI_Hs02_00312453 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035476 predicted 328
2 SASI_Hs02_00348609 predicted 447
3 SASI_Hs01_00035481 predicted 418
4 SASI_Hs01_00035484 predicted 450
5 SASI_Hs01_00035485 predicted 422
6 SASI_Hs02_00348610 predicted 410
7 SASI_Hs02_00348611 predicted 485
8 SASI_Hs02_00348612 predicted 448
9 SASI_Hs02_00348613 predicted 372
10 SASI_Hs02_00348614 predicted 355
11 SASI_Hs01_00035477 predicted 802
12 SASI_Hs01_00035478 predicted 692
13 SASI_Hs01_00035479 predicted 709
14 SASI_Hs01_00035480 predicted 580
15 SASI_Hs01_00035482 predicted 575
16 SASI_Hs01_00035483 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076095 predicted 645
2 SASI_Rn02_00202240 predicted 793
3 SASI_Rn01_00076096 predicted 497
4 SASI_Rn01_00076097 predicted 875
5 SASI_Rn01_00076098 predicted 1065
6 SASI_Rn02_00202241 predicted 798
7 SASI_Rn01_00076099 predicted 683
8 SASI_Rn01_00076100 predicted 702
9 SASI_Rn01_00076101 predicted 626
10 SASI_Rn01_00076102 predicted 601
11 SASI_Rn01_00076103 predicted 1193
12 SASI_Rn01_00076104 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112414 predicted 389
2 SASI_Mm01_00112415 predicted 297
3 SASI_Mm01_00112417 predicted 904
4 SASI_Mm01_00112418 predicted 381
5 SASI_Mm01_00112419 predicted 423
6 SASI_Mm01_00112420 predicted 752
7 SASI_Mm01_00112421 predicted 697
8 SASI_Mm01_00112422 predicted 484
9 SASI_Mm01_00112423 predicted 859
10 SASI_Mm02_00331731 predicted 281
11 SASI_Mm01_00112416 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027193
VALIDATED
DPH5 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-860s21c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027193.2-1285s21c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-956s21c1
Sequence:CCGGGGACTCTGAGCATGGACATTTCTCGAGAAATGTCCATGCTCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-300s21c1
Sequence:CCGGTAGAACAAGAAGCAGATAATACTCGAGTATTATCTGCTTCTTGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-380s21c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027193.2-1285s1c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027193.2-449s1c1
Sequence:CCGGGCCTCCATAATGAACGCTGTACTCGAGTACAGCGTTCATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-860s1c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-380s1c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-596s1c1
Sequence:CCGGCTGTGCTTACTCGATATCAAACTCGAGTTTGATATCGAGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027193
VALIDATED
DPH5 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-860s21c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027193.2-1285s21c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-956s21c1
Sequence:CCGGGGACTCTGAGCATGGACATTTCTCGAGAAATGTCCATGCTCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-300s21c1
Sequence:CCGGTAGAACAAGAAGCAGATAATACTCGAGTATTATCTGCTTCTTGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-380s21c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027193.2-1285s1c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027193.2-449s1c1
Sequence:CCGGGCCTCCATAATGAACGCTGTACTCGAGTACAGCGTTCATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-860s1c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-380s1c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-596s1c1
Sequence:CCGGCTGTGCTTACTCGATATCAAACTCGAGTTTGATATCGAGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027193
VALIDATED
DPH5 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-860s21c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027193.2-1285s21c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-956s21c1
Sequence:CCGGGGACTCTGAGCATGGACATTTCTCGAGAAATGTCCATGCTCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-300s21c1
Sequence:CCGGTAGAACAAGAAGCAGATAATACTCGAGTATTATCTGCTTCTTGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027193.2-380s21c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027193.2-1285s1c1
Sequence:CCGGGCAGCATGAATCAGCAAGAAACTCGAGTTTCTTGCTGATTCATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027193.2-449s1c1
Sequence:CCGGGCCTCCATAATGAACGCTGTACTCGAGTACAGCGTTCATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-860s1c1
Sequence:CCGGCCACTGCATTCTTTGGTCATTCTCGAGAATGACCAAAGAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-380s1c1
Sequence:CCGGGCTACAACACACAGTGATCTTCTCGAGAAGATCACTGTGTGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027193.2-596s1c1
Sequence:CCGGCTGTGCTTACTCGATATCAAACTCGAGTTTGATATCGAGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015958
VALIDATED
DPH5 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-500s21c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-313s21c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015958.2-379s21c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015958.2-1116s21c1
Sequence:CCGGAGGTGTTGTGGTAGGTAATTGCTCGAGCAATTACCTACCACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-793s21c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-469s1c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-282s1c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-941s1c1
Sequence:CCGGGATGGAGATGCTAAGTCTGTTCTCGAGAACAGACTTAGCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-798s1c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-221s1c1
Sequence:CCGGCTCAGTCCTAACTGTAGGGAACTCGAGTTCCCTACAGTTAGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-353s1c1
Sequence:CCGGCCTTGTGGTTGGTGATCCATTCTCGAGAATGGATCACCAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-348s1c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015958
VALIDATED
DPH5 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-500s21c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-313s21c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015958.2-379s21c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015958.2-1116s21c1
Sequence:CCGGAGGTGTTGTGGTAGGTAATTGCTCGAGCAATTACCTACCACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-793s21c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-469s1c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-282s1c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-941s1c1
Sequence:CCGGGATGGAGATGCTAAGTCTGTTCTCGAGAACAGACTTAGCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-798s1c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-221s1c1
Sequence:CCGGCTCAGTCCTAACTGTAGGGAACTCGAGTTCCCTACAGTTAGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-353s1c1
Sequence:CCGGCCTTGTGGTTGGTGATCCATTCTCGAGAATGGATCACCAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-348s1c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015958
VALIDATED
DPH5 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-500s21c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-313s21c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015958.2-379s21c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015958.2-1116s21c1
Sequence:CCGGAGGTGTTGTGGTAGGTAATTGCTCGAGCAATTACCTACCACAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015958.2-793s21c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-469s1c1
Sequence:CCGGGCTGCTGTGGTTTACAGTTATCTCGAGATAACTGTAAACCACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-282s1c1
Sequence:CCGGGCTGATAGAGAAGAAGTGGAACTCGAGTTCCACTTCTTCTCTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-941s1c1
Sequence:CCGGGATGGAGATGCTAAGTCTGTTCTCGAGAACAGACTTAGCATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-798s1c1
Sequence:CCGGGAGACACTTTGTGTTGGCTTACTCGAGTAAGCCAACACAAAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-221s1c1
Sequence:CCGGCTCAGTCCTAACTGTAGGGAACTCGAGTTCCCTACAGTTAGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015958.1-353s1c1
Sequence:CCGGCCTTGTGGTTGGTGATCCATTCTCGAGAATGGATCACCAACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015958.1-348s1c1
Sequence:CCGGGCATTCCTTGTGGTTGGTGATCTCGAGATCACCAACCACAAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks