EMAIL THIS PAGE TO A FRIEND

DPH6

diphthamine biosynthesis 6

178 Gene Product Result for
Synonyms: ATPBD4
UniProtKB ID: Q7L8W6, B3KWG1, Q96HJ6
Gene ID:
Mouse(66632) diphthamine biosynthesis 6
Rat(362191) diphthamine biosynthesis 6
naked mole-rat(101724973) DPH6 homolog (S. cerevisiae)
domestic guinea pig(100726776) diphthamine biosynthesis 6
Zebrafish(503603) DPH6 homolog (S. cerevisiae)
cow(767944) ATP binding domain 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001141972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001141972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001141972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087031 MISSION® esiRNA esiRNA targeting mouse Atpbd4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080650 Rosetta Predictions human pricing
NM_001014181 Rosetta Predictions rat pricing
NM_025675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362397 predicted 641
2 SASI_Hs01_00022115 predicted 262
3 SASI_Hs01_00022116 predicted 270
4 SASI_Hs02_00362398 predicted 571
5 SASI_Hs02_00362399 predicted 573
6 SASI_Hs01_00022117 predicted 472
7 SASI_Hs01_00022118 predicted 225
8 SASI_Hs01_00022119 predicted 886
9 SASI_Hs02_00362400 predicted 696
10 SASI_Hs01_00022120 predicted 885
11 SASI_Hs01_00022114 predicted 437
12 SASI_Hs01_00022121 predicted 462
13 SASI_Hs01_00022122 predicted 478
14 SASI_Hs01_00022123 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091531 predicted 503
2 SASI_Rn01_00091532 predicted 388
3 SASI_Rn01_00091534 predicted 402
4 SASI_Rn01_00091535 predicted 726
5 SASI_Rn02_00201684 predicted 738
6 SASI_Rn01_00091538 predicted 441
7 SASI_Rn01_00091539 predicted 649
8 SASI_Rn02_00201685 predicted 502
9 SASI_Rn02_00201686 predicted 939
10 SASI_Rn01_00091540 predicted 830
11 SASI_Rn01_00091533 predicted 299
12 SASI_Rn01_00091536 predicted 462
13 SASI_Rn01_00091537 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328811 predicted 427
2 SASI_Mm02_00328812 predicted 470
3 SASI_Mm02_00328813 predicted 366
4 SASI_Mm02_00328814 predicted 412
5 SASI_Mm02_00328815 predicted 575
6 SASI_Mm02_00328816 predicted 240
7 SASI_Mm02_00328817 predicted 610
8 SASI_Mm02_00328818 predicted 526
9 SASI_Mm02_00328819 predicted 721
10 SASI_Mm02_00328820 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001141972
DPH6 MISSION shRNA Bacterial Glycerol Stock
diphthamine biosynthesis 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-139s21c1
Sequence:CCGGAGATCGTTGCTTTAGCAAATCCTCGAGGATTTGCTAAAGCAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-387s21c1
Sequence:CCGGATGACCTTGCTTGCTGAATATCTCGAGATATTCAGCAAGCAAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-91s21c1
Sequence:CCGGGGAAGGACAGCTGCTATAATACTCGAGTATTATAGCAGCTGTCCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-265s21c1
Sequence:CCGGCCCTCTATCGCCGAACCATAACTCGAGTTATGGTTCGGCGATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141972.1-1644s21c1
Sequence:CCGGTATGAGTAGGTTGACATATTACTCGAGTAATATGTCAACCTACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001141972
DPH6 MISSION shRNA shRNA Plasmid DNA
diphthamine biosynthesis 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-139s21c1
Sequence:CCGGAGATCGTTGCTTTAGCAAATCCTCGAGGATTTGCTAAAGCAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-387s21c1
Sequence:CCGGATGACCTTGCTTGCTGAATATCTCGAGATATTCAGCAAGCAAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-91s21c1
Sequence:CCGGGGAAGGACAGCTGCTATAATACTCGAGTATTATAGCAGCTGTCCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-265s21c1
Sequence:CCGGCCCTCTATCGCCGAACCATAACTCGAGTTATGGTTCGGCGATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141972.1-1644s21c1
Sequence:CCGGTATGAGTAGGTTGACATATTACTCGAGTAATATGTCAACCTACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001141972
DPH6 MISSION shRNA Lentiviral Transduction Particles
diphthamine biosynthesis 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-139s21c1
Sequence:CCGGAGATCGTTGCTTTAGCAAATCCTCGAGGATTTGCTAAAGCAACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-387s21c1
Sequence:CCGGATGACCTTGCTTGCTGAATATCTCGAGATATTCAGCAAGCAAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-91s21c1
Sequence:CCGGGGAAGGACAGCTGCTATAATACTCGAGTATTATAGCAGCTGTCCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141972.1-265s21c1
Sequence:CCGGCCCTCTATCGCCGAACCATAACTCGAGTTATGGTTCGGCGATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141972.1-1644s21c1
Sequence:CCGGTATGAGTAGGTTGACATATTACTCGAGTAATATGTCAACCTACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025675
VALIDATED
DPH6 MISSION shRNA Bacterial Glycerol Stock
diphthamine biosynthesis 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-1743s21c1
Sequence:CCGGGACAATCAAGCTCGTTGTAATCTCGAGATTACAACGAGCTTGATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-200s21c1
Sequence:CCGGCAGATGAACTGGATAGCTATACTCGAGTATAGCTATCCAGTTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-407s21c1
Sequence:CCGGGGGTATCAGTAGGTGCTATACCTCGAGGTATAGCACCTACTGATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025675.4-541s21c1
Sequence:CCGGTCTAATATCAAGGCCATTATCCTCGAGGATAATGGCCTTGATATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-847s21c1
Sequence:CCGGGATGAAACAGCTAACTCTATACTCGAGTATAGAGTTAGCTGTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025675
VALIDATED
DPH6 MISSION shRNA shRNA Plasmid DNA
diphthamine biosynthesis 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-1743s21c1
Sequence:CCGGGACAATCAAGCTCGTTGTAATCTCGAGATTACAACGAGCTTGATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-200s21c1
Sequence:CCGGCAGATGAACTGGATAGCTATACTCGAGTATAGCTATCCAGTTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-407s21c1
Sequence:CCGGGGGTATCAGTAGGTGCTATACCTCGAGGTATAGCACCTACTGATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025675.4-541s21c1
Sequence:CCGGTCTAATATCAAGGCCATTATCCTCGAGGATAATGGCCTTGATATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-847s21c1
Sequence:CCGGGATGAAACAGCTAACTCTATACTCGAGTATAGAGTTAGCTGTTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025675
VALIDATED
DPH6 MISSION shRNA Lentiviral Transduction Particles
diphthamine biosynthesis 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-1743s21c1
Sequence:CCGGGACAATCAAGCTCGTTGTAATCTCGAGATTACAACGAGCTTGATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-200s21c1
Sequence:CCGGCAGATGAACTGGATAGCTATACTCGAGTATAGCTATCCAGTTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-407s21c1
Sequence:CCGGGGGTATCAGTAGGTGCTATACCTCGAGGTATAGCACCTACTGATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025675.4-541s21c1
Sequence:CCGGTCTAATATCAAGGCCATTATCCTCGAGGATAATGGCCTTGATATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025675.4-847s21c1
Sequence:CCGGGATGAAACAGCTAACTCTATACTCGAGTATAGAGTTAGCTGTTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)