EMAIL THIS PAGE TO A FRIEND

DPH7

diphthamide biosynthesis 7

Synonyms: C9orf112 RP11-48C7.3 RRT2 WDR85
Species: Human DPH7(92715), Mouse Dph7(67228), Zebrafish dph7(564032), domestic guinea pig Dph7(100712661)
Gene ID:
Human(92715) Summary: WDR85 is a WD repeat-containing protein that plays a role in the first step of diphthamide biosynthesis (Carette et al., 2009 [PubMed 19965467]
Mouse(67228) diphthamine biosynethesis 7
Zebrafish(564032) diphthamide biosynthesis 7
domestic guinea pig(100712661) diphthamide biosynthesis 7
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138778 Rosetta Predictions human pricing
NM_026044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173987 predicted 1282
2 SASI_Hs01_00173988 predicted 751
3 SASI_Hs01_00173989 predicted 427
4 SASI_Hs01_00173991 predicted 760
5 SASI_Hs01_00173992 predicted 926
6 SASI_Hs01_00173994 predicted 1221
7 SASI_Hs01_00173995 predicted 1219
8 SASI_Hs02_00363899 predicted 594
9 SASI_Hs02_00363900 predicted 949
10 SASI_Hs02_00363901 predicted 356
11 SASI_Hs01_00173986 predicted 428
12 SASI_Hs01_00173990 predicted 1514
13 SASI_Hs01_00173993 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199855 predicted 1125
2 SASI_Mm01_00199856 predicted 497
3 SASI_Mm01_00199857 predicted 1004
4 SASI_Mm01_00199858 predicted 217
5 SASI_Mm01_00199859 predicted 619
6 SASI_Mm02_00329549 predicted 801
7 SASI_Mm01_00199860 predicted 269
8 SASI_Mm01_00199861 predicted 295
9 SASI_Mm02_00329550 predicted 248
10 SASI_Mm01_00199862 predicted 575
11 SASI_Mm01_00199863 predicted 456
12 SASI_Mm01_00199864 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138778
VALIDATED
DPH7 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 7
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1433s21c1
Sequence:CCGGAGAAGCAGACTCAGCCTTCAGCTCGAGCTGAAGGCTGAGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1590s21c1
Sequence:CCGGCATCAGAGATGCTTACTGCAGCTCGAGCTGCAGTAAGCATCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1636s21c1
Sequence:CCGGGAATCCACAGTGTAGTCAGAACTCGAGTTCTGACTACACTGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-423s21c1
Sequence:CCGGTCTGCAATCCTGGACATGAAACTCGAGTTTCATGTCCAGGATTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-304s21c1
Sequence:CCGGAGAACAAGGGTGGAATGGAAGCTCGAGCTTCCATTCCACCCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1465s21c1
Sequence:CCGGCCTGCTCCTTCTATGACCATGCTCGAGCATGGTCATAGAAGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-328s21c1
Sequence:CCGGAGGAGCCTCAGGTCCGTTTAGCTCGAGCTAAACGGACCTGAGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-739s1c1
Sequence:CCGGCATCAATTCGAGGCCTGGATTCTCGAGAATCCAGGCCTCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-381s1c1
Sequence:CCGGCAACTCTATTCACCCTCTGGTCTCGAGACCAGAGGGTGAATAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-363s1c1
Sequence:CCGGGTACAGTTTCAATGACAACAACTCGAGTTGTTGTCATTGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-360s1c1
Sequence:CCGGCCTGTACAGTTTCAATGACAACTCGAGTTGTCATTGAAACTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1294s1c1
Sequence:CCGGGAATGCAGAGAGGATAACGATCTCGAGATCGTTATCCTCTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-760s1c1
Sequence:CCGGGCTGCTTTCAATTACTGGCATCTCGAGATGCCAGTAATTGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-763s1c1
Sequence:CCGGGCTTTCAATTACTGGCATCCACTCGAGTGGATGCCAGTAATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1065s1c1
Sequence:CCGGCATGCACAGTGGCTTTAAGATCTCGAGATCTTAAAGCCACTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-751s1c1
Sequence:CCGGGCCTGGATTGCTGCTTTCAATCTCGAGATTGAAAGCAGCAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1223s1c1
Sequence:CCGGCCTTTCCTAGCAACCTAGGAACTCGAGTTCCTAGGTTGCTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138778
VALIDATED
DPH7 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 7
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1433s21c1
Sequence:CCGGAGAAGCAGACTCAGCCTTCAGCTCGAGCTGAAGGCTGAGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1590s21c1
Sequence:CCGGCATCAGAGATGCTTACTGCAGCTCGAGCTGCAGTAAGCATCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1636s21c1
Sequence:CCGGGAATCCACAGTGTAGTCAGAACTCGAGTTCTGACTACACTGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-423s21c1
Sequence:CCGGTCTGCAATCCTGGACATGAAACTCGAGTTTCATGTCCAGGATTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-304s21c1
Sequence:CCGGAGAACAAGGGTGGAATGGAAGCTCGAGCTTCCATTCCACCCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1465s21c1
Sequence:CCGGCCTGCTCCTTCTATGACCATGCTCGAGCATGGTCATAGAAGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-328s21c1
Sequence:CCGGAGGAGCCTCAGGTCCGTTTAGCTCGAGCTAAACGGACCTGAGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-739s1c1
Sequence:CCGGCATCAATTCGAGGCCTGGATTCTCGAGAATCCAGGCCTCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-381s1c1
Sequence:CCGGCAACTCTATTCACCCTCTGGTCTCGAGACCAGAGGGTGAATAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-363s1c1
Sequence:CCGGGTACAGTTTCAATGACAACAACTCGAGTTGTTGTCATTGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-360s1c1
Sequence:CCGGCCTGTACAGTTTCAATGACAACTCGAGTTGTCATTGAAACTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1294s1c1
Sequence:CCGGGAATGCAGAGAGGATAACGATCTCGAGATCGTTATCCTCTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-760s1c1
Sequence:CCGGGCTGCTTTCAATTACTGGCATCTCGAGATGCCAGTAATTGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-763s1c1
Sequence:CCGGGCTTTCAATTACTGGCATCCACTCGAGTGGATGCCAGTAATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1065s1c1
Sequence:CCGGCATGCACAGTGGCTTTAAGATCTCGAGATCTTAAAGCCACTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-751s1c1
Sequence:CCGGGCCTGGATTGCTGCTTTCAATCTCGAGATTGAAAGCAGCAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1223s1c1
Sequence:CCGGCCTTTCCTAGCAACCTAGGAACTCGAGTTCCTAGGTTGCTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138778
VALIDATED
DPH7 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 7
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1433s21c1
Sequence:CCGGAGAAGCAGACTCAGCCTTCAGCTCGAGCTGAAGGCTGAGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1590s21c1
Sequence:CCGGCATCAGAGATGCTTACTGCAGCTCGAGCTGCAGTAAGCATCTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138778.2-1636s21c1
Sequence:CCGGGAATCCACAGTGTAGTCAGAACTCGAGTTCTGACTACACTGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-423s21c1
Sequence:CCGGTCTGCAATCCTGGACATGAAACTCGAGTTTCATGTCCAGGATTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-304s21c1
Sequence:CCGGAGAACAAGGGTGGAATGGAAGCTCGAGCTTCCATTCCACCCTTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-1465s21c1
Sequence:CCGGCCTGCTCCTTCTATGACCATGCTCGAGCATGGTCATAGAAGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138778.2-328s21c1
Sequence:CCGGAGGAGCCTCAGGTCCGTTTAGCTCGAGCTAAACGGACCTGAGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-739s1c1
Sequence:CCGGCATCAATTCGAGGCCTGGATTCTCGAGAATCCAGGCCTCGAATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-381s1c1
Sequence:CCGGCAACTCTATTCACCCTCTGGTCTCGAGACCAGAGGGTGAATAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_138778.1-363s1c1
Sequence:CCGGGTACAGTTTCAATGACAACAACTCGAGTTGTTGTCATTGAAACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-360s1c1
Sequence:CCGGCCTGTACAGTTTCAATGACAACTCGAGTTGTCATTGAAACTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1294s1c1
Sequence:CCGGGAATGCAGAGAGGATAACGATCTCGAGATCGTTATCCTCTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-760s1c1
Sequence:CCGGGCTGCTTTCAATTACTGGCATCTCGAGATGCCAGTAATTGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-763s1c1
Sequence:CCGGGCTTTCAATTACTGGCATCCACTCGAGTGGATGCCAGTAATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1065s1c1
Sequence:CCGGCATGCACAGTGGCTTTAAGATCTCGAGATCTTAAAGCCACTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-751s1c1
Sequence:CCGGGCCTGGATTGCTGCTTTCAATCTCGAGATTGAAAGCAGCAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138778.1-1223s1c1
Sequence:CCGGCCTTTCCTAGCAACCTAGGAACTCGAGTTCCTAGGTTGCTAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026044
DPH7 MISSION shRNA Bacterial Glycerol Stock
diphthamide biosynthesis 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-119s1c1
Sequence:CCGGCCAGTAGAAGGTTACCAGCATCTCGAGATGCTGGTAACCTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1160s1c1
Sequence:CCGGCCACCAATACATTCTCAGGAACTCGAGTTCCTGAGAATGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-459s1c1
Sequence:CCGGGTCTGTCCTTGTCAATGGATTCTCGAGAATCCATTGACAAGGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1014s1c1
Sequence:CCGGCCCACGAAATGCCTAACTCATCTCGAGATGAGTTAGGCATTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026044.1-1509s1c1
Sequence:CCGGCCAGCTCTACAACTAAGTGTTCTCGAGAACACTTAGTTGTAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026044
DPH7 MISSION shRNA shRNA Plasmid DNA
diphthamide biosynthesis 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-119s1c1
Sequence:CCGGCCAGTAGAAGGTTACCAGCATCTCGAGATGCTGGTAACCTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1160s1c1
Sequence:CCGGCCACCAATACATTCTCAGGAACTCGAGTTCCTGAGAATGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-459s1c1
Sequence:CCGGGTCTGTCCTTGTCAATGGATTCTCGAGAATCCATTGACAAGGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1014s1c1
Sequence:CCGGCCCACGAAATGCCTAACTCATCTCGAGATGAGTTAGGCATTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026044.1-1509s1c1
Sequence:CCGGCCAGCTCTACAACTAAGTGTTCTCGAGAACACTTAGTTGTAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026044
DPH7 MISSION shRNA Lentiviral Transduction Particles
diphthamide biosynthesis 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-119s1c1
Sequence:CCGGCCAGTAGAAGGTTACCAGCATCTCGAGATGCTGGTAACCTTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1160s1c1
Sequence:CCGGCCACCAATACATTCTCAGGAACTCGAGTTCCTGAGAATGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-459s1c1
Sequence:CCGGGTCTGTCCTTGTCAATGGATTCTCGAGAATCCATTGACAAGGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026044.1-1014s1c1
Sequence:CCGGCCCACGAAATGCCTAACTCATCTCGAGATGAGTTAGGCATTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026044.1-1509s1c1
Sequence:CCGGCCAGCTCTACAACTAAGTGTTCTCGAGAACACTTAGTTGTAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks