EMAIL THIS PAGE TO A FRIEND

DPM1

dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit

50 Gene Product Result for
Synonyms: CDGIE MPDS
UniProtKB ID: O60762, O15157, Q6IB78
Gene ID:
Human(8813) Summary: Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. [provided by RefSeq, Jul 2008]
Mouse(13480) dolichol-phosphate (beta-D) mannosyltransferase 1
Rat(296394) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Zebrafish(445202) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
cow(534097) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
domestic cat(101098859) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
dog(477264) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
chicken(419349) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
domestic guinea pig(100729877) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
naked mole-rat(101723294) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
sheep(101122969) dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003859 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036421 MISSION® esiRNA esiRNA human DPM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003859 Rosetta Predictions human pricing
NM_001106544 Rosetta Predictions rat pricing
NM_010072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043249 predicted 210
2 SASI_Hs01_00043250 predicted 646
3 SASI_Hs01_00043252 predicted 538
4 SASI_Hs01_00043253 predicted 661
5 SASI_Hs01_00043254 predicted 235
6 SASI_Hs01_00043255 predicted 285
7 SASI_Hs01_00043256 predicted 548
8 SASI_Hs01_00043257 predicted 544
9 SASI_Hs01_00043258 predicted 245
10 SASI_Hs02_00336440 predicted 672
11 SASI_Hs01_00043251 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219998 predicted 286
2 SASI_Rn02_00219999 predicted 321
3 SASI_Rn02_00220000 predicted 286
4 SASI_Rn02_00220001 predicted 757
5 SASI_Rn02_00220002 predicted 705
6 SASI_Rn02_00220003 predicted 762
7 SASI_Rn02_00220004 predicted 894
8 SASI_Rn02_00220005 predicted 216
9 SASI_Rn02_00220006 predicted 566
10 SASI_Rn02_00220007 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033018 predicted 901
2 SASI_Mm01_00033019 predicted 812
3 SASI_Mm01_00033020 predicted 281
4 SASI_Mm01_00033021 predicted 688
5 SASI_Mm01_00033022 predicted 327
6 SASI_Mm01_00033023 predicted 480
7 SASI_Mm01_00033024 predicted 256
8 SASI_Mm01_00033025 predicted 786
9 SASI_Mm01_00033026 predicted 730
10 SASI_Mm02_00317753 predicted 721
11 SASI_Mm01_00033027 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010072
VALIDATED
DPM1 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-637s1c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-636s1c1
Sequence:CCGGGCTATGTCTTTCAGATGGAAACTCGAGTTTCCATCTGAAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010072.2-404s1c1
Sequence:CCGGCCTGAATTTATCAGGAAACAACTCGAGTTGTTTCCTGATAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-825s1c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-178s1c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-316s21c1
Sequence:CCGGGTCTCGGAACTGCCTACATTCCTCGAGGAATGTAGGCAGTTCCGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-767s21c1
Sequence:CCGGCTCGTTCCTGAAAGGGTTATTCTCGAGAATAACCCTTTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-644s21c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-832s21c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-185s21c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010072
VALIDATED
DPM1 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-637s1c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-636s1c1
Sequence:CCGGGCTATGTCTTTCAGATGGAAACTCGAGTTTCCATCTGAAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010072.2-404s1c1
Sequence:CCGGCCTGAATTTATCAGGAAACAACTCGAGTTGTTTCCTGATAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-825s1c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-178s1c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-316s21c1
Sequence:CCGGGTCTCGGAACTGCCTACATTCCTCGAGGAATGTAGGCAGTTCCGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-767s21c1
Sequence:CCGGCTCGTTCCTGAAAGGGTTATTCTCGAGAATAACCCTTTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-644s21c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-832s21c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-185s21c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010072
VALIDATED
DPM1 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-637s1c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-636s1c1
Sequence:CCGGGCTATGTCTTTCAGATGGAAACTCGAGTTTCCATCTGAAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010072.2-404s1c1
Sequence:CCGGCCTGAATTTATCAGGAAACAACTCGAGTTGTTTCCTGATAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-825s1c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010072.2-178s1c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-316s21c1
Sequence:CCGGGTCTCGGAACTGCCTACATTCCTCGAGGAATGTAGGCAGTTCCGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-767s21c1
Sequence:CCGGCTCGTTCCTGAAAGGGTTATTCTCGAGAATAACCCTTTCAGGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-644s21c1
Sequence:CCGGCTATGTCTTTCAGATGGAAATCTCGAGATTTCCATCTGAAAGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-832s21c1
Sequence:CCGGCCCGTGTTCATTTCAATTAAACTCGAGTTTAATTGAAATGAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010072.3-185s21c1
Sequence:CCGGGAGTGCAATCAACTATGAAATCTCGAGATTTCATAGTTGATTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003859
VALIDATED
DPM1 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-326s1c1
Sequence:CCGGCCACAGGAAACTACATCATTACTCGAGTAATGATGTAGTTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-455s1c1
Sequence:CCGGGAGGTGTATATGGCTGGGATTCTCGAGAATCCCAGCCATATACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-711s1c1
Sequence:CCGGTGAATCCAAGTTGGGAGGAAACTCGAGTTTCCTCCCAACTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-679s1c1
Sequence:CCGGGTTCCAATATCATTTGTGGATCTCGAGATCCACAAATGATATTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003859.1-59s1c1
Sequence:CCGGGCAGTCCACGACAGAACAAATCTCGAGATTTGTTCTGTCGTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-687s21c1
Sequence:CCGGATCATTTGTGGATCGTGTTTACTCGAGTAAACACGATCCACAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-62s21c1
Sequence:GTACCGGGTCCACGACAGAACAAATATTCTCGAGAATATTTGTTCTGTCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-805s21c1
Sequence:CCGGTTACGTTCATTTCAGGTTAAACTCGAGTTTAACCTGAAATGAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-645s21c1
Sequence:CCGGTCGGGCAAGACAGTTGAATTACTCGAGTAATTCAACTGTCTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-289s21c1
Sequence:CCGGGGACTAGGAACTGCATATATTCTCGAGAATATATGCAGTTCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003859
VALIDATED
DPM1 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-326s1c1
Sequence:CCGGCCACAGGAAACTACATCATTACTCGAGTAATGATGTAGTTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-455s1c1
Sequence:CCGGGAGGTGTATATGGCTGGGATTCTCGAGAATCCCAGCCATATACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-711s1c1
Sequence:CCGGTGAATCCAAGTTGGGAGGAAACTCGAGTTTCCTCCCAACTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-679s1c1
Sequence:CCGGGTTCCAATATCATTTGTGGATCTCGAGATCCACAAATGATATTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003859.1-59s1c1
Sequence:CCGGGCAGTCCACGACAGAACAAATCTCGAGATTTGTTCTGTCGTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-687s21c1
Sequence:CCGGATCATTTGTGGATCGTGTTTACTCGAGTAAACACGATCCACAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-62s21c1
Sequence:GTACCGGGTCCACGACAGAACAAATATTCTCGAGAATATTTGTTCTGTCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-805s21c1
Sequence:CCGGTTACGTTCATTTCAGGTTAAACTCGAGTTTAACCTGAAATGAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-645s21c1
Sequence:CCGGTCGGGCAAGACAGTTGAATTACTCGAGTAATTCAACTGTCTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-289s21c1
Sequence:CCGGGGACTAGGAACTGCATATATTCTCGAGAATATATGCAGTTCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003859
VALIDATED
DPM1 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-326s1c1
Sequence:CCGGCCACAGGAAACTACATCATTACTCGAGTAATGATGTAGTTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-455s1c1
Sequence:CCGGGAGGTGTATATGGCTGGGATTCTCGAGAATCCCAGCCATATACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-711s1c1
Sequence:CCGGTGAATCCAAGTTGGGAGGAAACTCGAGTTTCCTCCCAACTTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003859.1-679s1c1
Sequence:CCGGGTTCCAATATCATTTGTGGATCTCGAGATCCACAAATGATATTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003859.1-59s1c1
Sequence:CCGGGCAGTCCACGACAGAACAAATCTCGAGATTTGTTCTGTCGTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-687s21c1
Sequence:CCGGATCATTTGTGGATCGTGTTTACTCGAGTAAACACGATCCACAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-62s21c1
Sequence:GTACCGGGTCCACGACAGAACAAATATTCTCGAGAATATTTGTTCTGTCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-805s21c1
Sequence:CCGGTTACGTTCATTTCAGGTTAAACTCGAGTTTAACCTGAAATGAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003859.1-645s21c1
Sequence:CCGGTCGGGCAAGACAGTTGAATTACTCGAGTAATTCAACTGTCTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003859.1-289s21c1
Sequence:CCGGGGACTAGGAACTGCATATATTCTCGAGAATATATGCAGTTCCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks