EMAIL THIS PAGE TO A FRIEND

DPM2

dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit

42 Gene Product Result for
Synonyms: CDG1U
UniProtKB ID: O94777, Q5XKK9, Q6FGH3
Gene ID:
Human(8818) Summary: Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a hydrophobic protein that contains 2 predicted transmembrane domains and a putative ER localization signal near the C terminus. This protein associates with DPM1 in vivo and is required for the ER localization and stable expression of DPM1 and also enhances the binding of dolichol-phosphate to DPM1. [provided by RefSeq, Jul 2008]
Mouse(13481) dolichol-phosphate (beta-D) mannosyltransferase 2
Rat(29640) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
sheep(101122767) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
naked mole-rat(101716252) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
domestic guinea pig(100725474) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Zebrafish(796295) dolichol-phosphate (beta-D) mannosyltransferase 2
domestic cat(101098016) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
cow(523737) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
chicken(771539) dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003863 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003863 Rosetta Predictions human pricing
NM_019252 Rosetta Predictions rat pricing
NM_010073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167962 predicted 618
2 SASI_Hs01_00167963 predicted 557
3 SASI_Hs01_00167964 predicted 634
4 SASI_Hs01_00167965 predicted 261
5 SASI_Hs01_00167966 predicted 619
6 SASI_Hs01_00167967 predicted 640
7 SASI_Hs01_00167968 predicted 421
8 SASI_Hs01_00167969 predicted 226
9 SASI_Hs01_00167970 predicted 419
10 SASI_Hs01_00167971 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060912 predicted 28
2 SASI_Rn01_00060913 predicted 611
3 SASI_Rn01_00060914 predicted 38
4 SASI_Rn01_00060915 predicted 455
5 SASI_Rn01_00060916 predicted 27
6 SASI_Rn01_00060917 predicted 9
7 SASI_Rn01_00060918 predicted 45
8 SASI_Rn01_00060920 predicted 376
9 SASI_Rn01_00060921 predicted 531
10 SASI_Rn02_00262130 predicted 538
11 SASI_Rn01_00060919 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132890 predicted 331
2 SASI_Mm01_00132891 predicted 371
3 SASI_Mm01_00132892 predicted 522
4 SASI_Mm01_00132893 predicted 247
5 SASI_Mm01_00132894 predicted 488
6 SASI_Mm01_00132895 predicted 498
7 SASI_Mm01_00132896 predicted 244
8 SASI_Mm01_00132897 predicted 513
9 SASI_Mm01_00132898 predicted 278
10 SASI_Mm01_00132899 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010073
VALIDATED
DPM2 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010073.2-558s21c2
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-146s21c2
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-94s21c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-163s21c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-558s1c1
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-94s1c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-163s1c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010073.2-245s1c1
Sequence:CCGGGTGGGATTGTTCATCACCTATCTCGAGATAGGTGATGAACAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-146s1c1
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010073
VALIDATED
DPM2 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010073.2-558s21c2
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-146s21c2
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-94s21c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-163s21c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-558s1c1
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-94s1c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-163s1c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010073.2-245s1c1
Sequence:CCGGGTGGGATTGTTCATCACCTATCTCGAGATAGGTGATGAACAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-146s1c1
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010073
VALIDATED
DPM2 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010073.2-558s21c2
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-146s21c2
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-94s21c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010073.2-163s21c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-558s1c1
Sequence:CCGGCCTGTCCATCTCACAGTCAAACTCGAGTTTGACTGTGAGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-94s1c1
Sequence:CCGGCGCCGTTAGCTTGATCATCTTCTCGAGAAGATGATCAAGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-163s1c1
Sequence:CCGGGCATGTCATCCACAAATACTTCTCGAGAAGTATTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010073.2-245s1c1
Sequence:CCGGGTGGGATTGTTCATCACCTATCTCGAGATAGGTGATGAACAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010073.2-146s1c1
Sequence:CCGGCCATTCATTGACAGCCAGCATCTCGAGATGCTGGCTGTCAATGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003863
VALIDATED
DPM2 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-77s21c1
Sequence:CCGGTCGCCGTTAGCCTGATCATCTCTCGAGAGATGATCAGGCTAACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-230s21c1
Sequence:CCGGTGGGACTGTTCATCTCCTATGCTCGAGCATAGGAGATGAACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-147s21c1
Sequence:CCGGGCATGTCATCCACAAGTATTTCTCGAGAAATACTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003863.2-626s21c1
Sequence:CCGGACATGCTGACGTTGGACTTAGCTCGAGCTAAGTCCAACGTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.3-706s21c1
Sequence:CCGGCGCCGTTAGCCTGATCATCTTCTCGAGAAGATGATCAGGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-745s21c1
Sequence:CCGGGGTGATTCTCTTGCCATTCATCTCGAGATGAATGGCAAGAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-261s21c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-518s21c1
Sequence:CCGGCCTTCTTGCTCAGGGCCTAAACTCGAGTTTAGGCCCTGAGCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-103s21c1
Sequence:CCGGTACTACACCGCCTGGGTGATTCTCGAGAATCACCCAGGCGGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-1264s21c1
Sequence:CCGGGTTGGACTTAGCAGGTTCTAACTCGAGTTAGAACCTGCTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-774s21c1
Sequence:CCGGAGCATGTCATCCACAAGTATTCTCGAGAATACTTGTGGATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003863.2-219s1c1
Sequence:CCGGGCTCCTGTTTGTGGGACTGTTCTCGAGAACAGTCCCACAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-261s1c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-145s1c1
Sequence:CCGGCAGCATGTCATCCACAAGTATCTCGAGATACTTGTGGATGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003863
VALIDATED
DPM2 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-77s21c1
Sequence:CCGGTCGCCGTTAGCCTGATCATCTCTCGAGAGATGATCAGGCTAACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-230s21c1
Sequence:CCGGTGGGACTGTTCATCTCCTATGCTCGAGCATAGGAGATGAACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-147s21c1
Sequence:CCGGGCATGTCATCCACAAGTATTTCTCGAGAAATACTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003863.2-626s21c1
Sequence:CCGGACATGCTGACGTTGGACTTAGCTCGAGCTAAGTCCAACGTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.3-706s21c1
Sequence:CCGGCGCCGTTAGCCTGATCATCTTCTCGAGAAGATGATCAGGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-745s21c1
Sequence:CCGGGGTGATTCTCTTGCCATTCATCTCGAGATGAATGGCAAGAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-261s21c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-518s21c1
Sequence:CCGGCCTTCTTGCTCAGGGCCTAAACTCGAGTTTAGGCCCTGAGCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-103s21c1
Sequence:CCGGTACTACACCGCCTGGGTGATTCTCGAGAATCACCCAGGCGGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-1264s21c1
Sequence:CCGGGTTGGACTTAGCAGGTTCTAACTCGAGTTAGAACCTGCTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-774s21c1
Sequence:CCGGAGCATGTCATCCACAAGTATTCTCGAGAATACTTGTGGATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003863.2-219s1c1
Sequence:CCGGGCTCCTGTTTGTGGGACTGTTCTCGAGAACAGTCCCACAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-261s1c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-145s1c1
Sequence:CCGGCAGCATGTCATCCACAAGTATCTCGAGATACTTGTGGATGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003863
VALIDATED
DPM2 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-77s21c1
Sequence:CCGGTCGCCGTTAGCCTGATCATCTCTCGAGAGATGATCAGGCTAACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-230s21c1
Sequence:CCGGTGGGACTGTTCATCTCCTATGCTCGAGCATAGGAGATGAACAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-147s21c1
Sequence:CCGGGCATGTCATCCACAAGTATTTCTCGAGAAATACTTGTGGATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003863.2-626s21c1
Sequence:CCGGACATGCTGACGTTGGACTTAGCTCGAGCTAAGTCCAACGTCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.3-706s21c1
Sequence:CCGGCGCCGTTAGCCTGATCATCTTCTCGAGAAGATGATCAGGCTAACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-745s21c1
Sequence:CCGGGGTGATTCTCTTGCCATTCATCTCGAGATGAATGGCAAGAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-261s21c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.2-518s21c1
Sequence:CCGGCCTTCTTGCTCAGGGCCTAAACTCGAGTTTAGGCCCTGAGCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003863.2-103s21c1
Sequence:CCGGTACTACACCGCCTGGGTGATTCTCGAGAATCACCCAGGCGGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-1264s21c1
Sequence:CCGGGTTGGACTTAGCAGGTTCTAACTCGAGTTAGAACCTGCTAAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003863.3-774s21c1
Sequence:CCGGAGCATGTCATCCACAAGTATTCTCGAGAATACTTGTGGATGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003863.2-219s1c1
Sequence:CCGGGCTCCTGTTTGTGGGACTGTTCTCGAGAACAGTCCCACAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-261s1c1
Sequence:CCGGGACCAAGAGAGTGACCAAGAACTCGAGTTCTTGGTCACTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003863.2-145s1c1
Sequence:CCGGCAGCATGTCATCCACAAGTATCTCGAGATACTTGTGGATGACATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks