EMAIL THIS PAGE TO A FRIEND

DPM3

dolichyl-phosphate mannosyltransferase polypeptide 3

58 Gene Product Result for
Synonyms: CDG1O
UniProtKB ID: Q9P2X0, Q5SR62, Q5SR63, Q9BXN4, Q9BXN5
Gene ID:
Human(54344) Summary: Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a subunit of dolichyl-phosphate mannosyltransferase and acts as a stabilizer subunit of the dolichyl-phosphate mannosyltransferase complex. [provided by RefSeq, Jul 2008]
Mouse(68563) dolichyl-phosphate mannosyltransferase polypeptide 3
Rat(502017) dolichyl-phosphate mannosyltransferase polypeptide 3
Zebrafish(393782) dolichyl-phosphate mannosyltransferase polypeptide 3
cow(509745) dolichyl-phosphate mannosyltransferase polypeptide 3
domestic cat(101091753) dolichyl-phosphate mannosyltransferase polypeptide 3
dog(490430) dolichyl-phosphate mannosyltransferase polypeptide 3
domestic guinea pig(100732686) dolichyl-phosphate mannosyltransferase polypeptide 3
naked mole-rat(101708315) dolichyl-phosphate mannosyltransferase polypeptide 3
sheep(101116108) dolichyl-phosphate mannosyltransferase polypeptide 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014667 Anti-DPM3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018973 Rosetta Predictions human pricing
NM_153741 Rosetta Predictions human pricing
NM_001109331 Rosetta Predictions rat pricing
NM_026767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038753 predicted 333
2 SASI_Hs01_00038754 predicted 427
3 SASI_Hs01_00038755 predicted 148
4 SASI_Hs02_00352456 predicted 165
5 SASI_Hs02_00352457 predicted 256
6 SASI_Hs01_00038756 predicted 376
7 SASI_Hs01_00038757 predicted 462
8 SASI_Hs01_00038758 predicted 322
9 SASI_Hs01_00038760 predicted 278
10 SASI_Hs01_00038761 predicted 403
11 SASI_Hs01_00038759 predicted 380
12 SASI_Hs01_00038762 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149730 predicted 201
2 SASI_Hs01_00149731 predicted 293
3 SASI_Hs02_00367452 predicted 36
4 SASI_Hs01_00149732 predicted 117
5 SASI_Hs01_00149733 predicted 238
6 SASI_Hs01_00149734 predicted 329
7 SASI_Hs01_00149735 predicted 195
8 SASI_Hs01_00149737 predicted 151
9 SASI_Hs01_00149738 predicted 262
10 SASI_Hs02_00367453 predicted 64
11 SASI_Hs01_00149736 predicted 251
12 SASI_Hs01_00149739 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247374 predicted 228
2 SASI_Rn02_00247375 predicted 334
3 SASI_Rn02_00247376 predicted 304
4 SASI_Rn02_00247377 predicted 219
5 SASI_Rn02_00247378 predicted 284
6 SASI_Rn02_00247379 predicted 163
7 SASI_Rn02_00247380 predicted 216
8 SASI_Rn02_00247381 predicted 320
9 SASI_Rn02_00247382 predicted 111
10 SASI_Rn02_00247383 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065707 predicted 56
2 SASI_Mm02_00330830 predicted 227
3 SASI_Mm02_00330831 predicted 187
4 SASI_Mm02_00330832 predicted 160
5 SASI_Mm02_00330833 predicted 222
6 SASI_Mm01_00065698 predicted 350
7 SASI_Mm01_00065699 predicted 231
8 SASI_Mm01_00065700 predicted 322
9 SASI_Mm01_00065701 predicted 299
10 SASI_Mm01_00065702 predicted 340
11 SASI_Mm01_00065703 predicted 342
12 SASI_Mm01_00065704 predicted 296
13 SASI_Mm01_00065705 predicted 228
14 SASI_Mm01_00065706 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018973
VALIDATED
DPM3 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-159s1c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-172s1c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018973.3-166s1c1
Sequence:CCGGCCATGACGAAATTAGCGCAGTCTCGAGACTGCGCTAATTTCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-326s21c1
Sequence:CCGGCCTGGGCACTGTGGGCTATCGCTCGAGCGATAGCCCACAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-357s21c1
Sequence:CCGGTTTCATGACTGCGAGGACGCCCTCGAGGGCGTCCTCGCAGTCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-172s21c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-159s21c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-262s21c1
Sequence:CCGGTGTCCTGCCAGGAAGTCCTGTCTCGAGACAGGACTTCCTGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-145s21c1
Sequence:CCGGTGCTTCCTTCTCTCGCAGTGACTCGAGTCACTGCGAGAGAAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-118s21c1
Sequence:CCGGTTTCCTTTCTGCTCCTCAGGGCTCGAGCCCTGAGGAGCAGAAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-198s21c1
Sequence:CCGGCTAGCGATCCTGGGCTCCACCCTCGAGGGTGGAGCCCAGGATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018973
VALIDATED
DPM3 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-159s1c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-172s1c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018973.3-166s1c1
Sequence:CCGGCCATGACGAAATTAGCGCAGTCTCGAGACTGCGCTAATTTCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-326s21c1
Sequence:CCGGCCTGGGCACTGTGGGCTATCGCTCGAGCGATAGCCCACAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-357s21c1
Sequence:CCGGTTTCATGACTGCGAGGACGCCCTCGAGGGCGTCCTCGCAGTCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-172s21c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-159s21c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-262s21c1
Sequence:CCGGTGTCCTGCCAGGAAGTCCTGTCTCGAGACAGGACTTCCTGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-145s21c1
Sequence:CCGGTGCTTCCTTCTCTCGCAGTGACTCGAGTCACTGCGAGAGAAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-118s21c1
Sequence:CCGGTTTCCTTTCTGCTCCTCAGGGCTCGAGCCCTGAGGAGCAGAAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-198s21c1
Sequence:CCGGCTAGCGATCCTGGGCTCCACCCTCGAGGGTGGAGCCCAGGATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018973
VALIDATED
DPM3 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-159s1c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018973.3-172s1c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018973.3-166s1c1
Sequence:CCGGCCATGACGAAATTAGCGCAGTCTCGAGACTGCGCTAATTTCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-326s21c1
Sequence:CCGGCCTGGGCACTGTGGGCTATCGCTCGAGCGATAGCCCACAGTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-357s21c1
Sequence:CCGGTTTCATGACTGCGAGGACGCCCTCGAGGGCGTCCTCGCAGTCATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-172s21c1
Sequence:CCGGCGAAATTAGCGCAGTGGCTTTCTCGAGAAAGCCACTGCGCTAATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-159s21c1
Sequence:CCGGGCAGTGACCATGACGAAATTACTCGAGTAATTTCGTCATGGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-262s21c1
Sequence:CCGGTGTCCTGCCAGGAAGTCCTGTCTCGAGACAGGACTTCCTGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-145s21c1
Sequence:CCGGTGCTTCCTTCTCTCGCAGTGACTCGAGTCACTGCGAGAGAAGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018973.3-118s21c1
Sequence:CCGGTTTCCTTTCTGCTCCTCAGGGCTCGAGCCCTGAGGAGCAGAAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018973.3-198s21c1
Sequence:CCGGCTAGCGATCCTGGGCTCCACCCTCGAGGGTGGAGCCCAGGATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026767
DPM3 MISSION shRNA Bacterial Glycerol Stock
dolichyl-phosphate mannosyltransferase polypeptide 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-135s21c1
Sequence:CCGGACTGGGCTTGGAGTTGCCTTTCTCGAGAAAGGCAACTCCAAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-180s21c1
Sequence:CCGGACTGCCTGCCTACCTGTTGGTCTCGAGACCAACAGGTAGGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-119s21c1
Sequence:CCGGCCCTGACCATGGGAGCACTGGCTCGAGCCAGTGCTCCCATGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-196s21c1
Sequence:CCGGTTGGTCTCCGCTGGCTGCTATCTCGAGATAGCAGCCAGCGGAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-232s21c1
Sequence:CCGGGGCTATCGCGTAGCTACATTTCTCGAGAAATGTAGCTACGCGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026767
DPM3 MISSION shRNA shRNA Plasmid DNA
dolichyl-phosphate mannosyltransferase polypeptide 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-135s21c1
Sequence:CCGGACTGGGCTTGGAGTTGCCTTTCTCGAGAAAGGCAACTCCAAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-180s21c1
Sequence:CCGGACTGCCTGCCTACCTGTTGGTCTCGAGACCAACAGGTAGGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-119s21c1
Sequence:CCGGCCCTGACCATGGGAGCACTGGCTCGAGCCAGTGCTCCCATGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-196s21c1
Sequence:CCGGTTGGTCTCCGCTGGCTGCTATCTCGAGATAGCAGCCAGCGGAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-232s21c1
Sequence:CCGGGGCTATCGCGTAGCTACATTTCTCGAGAAATGTAGCTACGCGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026767
DPM3 MISSION shRNA Lentiviral Transduction Particles
dolichyl-phosphate mannosyltransferase polypeptide 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-135s21c1
Sequence:CCGGACTGGGCTTGGAGTTGCCTTTCTCGAGAAAGGCAACTCCAAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-180s21c1
Sequence:CCGGACTGCCTGCCTACCTGTTGGTCTCGAGACCAACAGGTAGGCAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-119s21c1
Sequence:CCGGCCCTGACCATGGGAGCACTGGCTCGAGCCAGTGCTCCCATGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-196s21c1
Sequence:CCGGTTGGTCTCCGCTGGCTGCTATCTCGAGATAGCAGCCAGCGGAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026767.3-232s21c1
Sequence:CCGGGGCTATCGCGTAGCTACATTTCTCGAGAAATGTAGCTACGCGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks