EMAIL THIS PAGE TO A FRIEND

DPP10

dipeptidyl-peptidase 10 (non-functional)

Synonyms: DPL2 DPPY DPRP3
Gene ID:
Human(57628) Summary: This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(269109) dipeptidylpeptidase 10
Rat(363972) dipeptidylpeptidase 10
chicken(424280) dipeptidyl-peptidase 10 (non-functional)
dog(476121) dipeptidyl-peptidase 10 (non-functional)
domestic cat(101086917) dipeptidyl-peptidase 10 (non-functional)
Horse(100053255) dipeptidyl-peptidase 10 (non-functional)
cow(617222) dipeptidyl-peptidase 10 (non-functional)
sheep(101109248) dipeptidyl-peptidase 10 (non-functional)
Domestic Rabbit(100346104) dipeptidyl-peptidase 10 (non-functional)
domestic guinea pig(100714259) dipeptidyl-peptidase 10 (non-functional)
naked mole-rat(101716881) dipeptidyl-peptidase 10 (non-functional)
223 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020868 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023921 MISSION® esiRNA esiRNA human DPP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004360 Rosetta Predictions human pricing
NM_020868 Rosetta Predictions human pricing
NM_001012205 Rosetta Predictions rat pricing
XM_577266 Rosetta Predictions rat pricing
NM_199021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083515 predicted 1025
2 SASI_Hs01_00083516 predicted 352
3 SASI_Hs01_00083519 predicted 2363
4 SASI_Hs01_00083520 predicted 854
5 SASI_Hs01_00083521 predicted 1733
6 SASI_Hs01_00083523 predicted 950
7 SASI_Hs02_00304576 predicted 1894
8 SASI_Hs01_00083524 predicted 844
9 SASI_Hs02_00304577 predicted 323
10 SASI_Hs02_00304578 predicted 2471
11 SASI_Hs01_00083517 predicted 1329
12 SASI_Hs01_00083518 predicted 1116
13 SASI_Hs01_00083522 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100976 predicted 1418
2 SASI_Hs01_00100977 predicted 745
3 SASI_Hs01_00100980 predicted 2768
4 SASI_Hs01_00100981 predicted 1255
5 SASI_Hs01_00100982 predicted 2125
6 SASI_Hs01_00100984 predicted 1348
7 SASI_Hs02_00354163 predicted 2295
8 SASI_Hs01_00100985 predicted 1239
9 SASI_Hs02_00354164 predicted 720
10 SASI_Hs02_00354165 predicted 2866
11 SASI_Hs01_00100978 predicted 1725
12 SASI_Hs01_00100979 predicted 1513
13 SASI_Hs01_00100983 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112443 predicted 2114
2 SASI_Rn01_00112444 predicted 1515
3 SASI_Rn02_00200446 predicted 1343
4 SASI_Rn01_00112446 predicted 454
5 SASI_Rn01_00112447 predicted 2033
6 SASI_Rn02_00200447 predicted 886
7 SASI_Rn01_00112448 predicted 1287
8 SASI_Rn01_00112450 predicted 1203
9 SASI_Rn01_00112451 predicted 350
10 SASI_Rn02_00200448 predicted 1766
11 SASI_Rn01_00112445 predicted 805
12 SASI_Rn01_00112449 predicted 1606
13 SASI_Rn01_00112452 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184897 predicted 1675
2 SASI_Rn01_00184898 predicted 1165
3 SASI_Rn01_00184899 predicted 1164
4 SASI_Rn01_00184900 predicted 1162
5 SASI_Rn01_00184901 predicted 1248
6 SASI_Rn01_00184902 predicted 1327
7 SASI_Rn01_00184903 predicted 1596
8 SASI_Rn01_00184904 predicted 1174
9 SASI_Rn01_00184905 predicted 1337
10 SASI_Rn01_00184906 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351277 predicted 2318
2 SASI_Mm01_00020683 predicted 1468
3 SASI_Mm01_00020684 predicted 1528
4 SASI_Mm01_00020685 predicted 2428
5 SASI_Mm01_00020687 predicted 408
6 SASI_Mm02_00351278 predicted 2079
7 SASI_Mm01_00020688 predicted 440
8 SASI_Mm01_00020690 predicted 570
9 SASI_Mm01_00020691 predicted 1402
10 SASI_Mm01_00020692 predicted 1008
11 SASI_Mm01_00020686 predicted 752
12 SASI_Mm01_00020689 predicted 1587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199021
DPP10 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 10 (non-functional)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2237s21c1
Sequence:CCGGGGCATCCAGTGTACTGCATAACTCGAGTTATGCAGTACACTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2168s21c1
Sequence:CCGGGAAGTTGTATGCCTCAGCTTTCTCGAGAAAGCTGAGGCATACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2206s21c1
Sequence:CCGGGCATGCCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199021.2-3300s1c1
Sequence:CCGGGCTTCTTTATTGAGCCAAATACTCGAGTATTTGGCTCAATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-1878s1c1
Sequence:CCGGCAGTTCTTATTGACACCGATACTCGAGTATCGGTGTCAATAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-291s1c1
Sequence:CCGGCACCAGATGAACTAACAAATTCTCGAGAATTTGTTAGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-880s1c1
Sequence:CCGGCCTGATGATAAATGACTCGTTCTCGAGAACGAGTCATTTATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-744s1c1
Sequence:CCGGGCAGTTCTTTACGACTAACATCTCGAGATGTTAGTCGTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199021
DPP10 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 10 (non-functional)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2237s21c1
Sequence:CCGGGGCATCCAGTGTACTGCATAACTCGAGTTATGCAGTACACTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2168s21c1
Sequence:CCGGGAAGTTGTATGCCTCAGCTTTCTCGAGAAAGCTGAGGCATACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2206s21c1
Sequence:CCGGGCATGCCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199021.2-3300s1c1
Sequence:CCGGGCTTCTTTATTGAGCCAAATACTCGAGTATTTGGCTCAATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-1878s1c1
Sequence:CCGGCAGTTCTTATTGACACCGATACTCGAGTATCGGTGTCAATAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-291s1c1
Sequence:CCGGCACCAGATGAACTAACAAATTCTCGAGAATTTGTTAGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-880s1c1
Sequence:CCGGCCTGATGATAAATGACTCGTTCTCGAGAACGAGTCATTTATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-744s1c1
Sequence:CCGGGCAGTTCTTTACGACTAACATCTCGAGATGTTAGTCGTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199021
DPP10 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 10 (non-functional)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2237s21c1
Sequence:CCGGGGCATCCAGTGTACTGCATAACTCGAGTTATGCAGTACACTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2168s21c1
Sequence:CCGGGAAGTTGTATGCCTCAGCTTTCTCGAGAAAGCTGAGGCATACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199021.3-2206s21c1
Sequence:CCGGGCATGCCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199021.2-3300s1c1
Sequence:CCGGGCTTCTTTATTGAGCCAAATACTCGAGTATTTGGCTCAATAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-1878s1c1
Sequence:CCGGCAGTTCTTATTGACACCGATACTCGAGTATCGGTGTCAATAAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-291s1c1
Sequence:CCGGCACCAGATGAACTAACAAATTCTCGAGAATTTGTTAGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-880s1c1
Sequence:CCGGCCTGATGATAAATGACTCGTTCTCGAGAACGAGTCATTTATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199021.2-744s1c1
Sequence:CCGGGCAGTTCTTTACGACTAACATCTCGAGATGTTAGTCGTAAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020868
DPP10 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 10 (non-functional)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-716s1c1
Sequence:CCGGCGGTGGATCAATGATACAGATCTCGAGATCTGTATCATTGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2293s1c1
Sequence:CCGGGCAGGAGATTCATCGAAGATTCTCGAGAATCTTCGATGAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-791s1c1
Sequence:CCGGGCTACCACATTATTATTGGAACTCGAGTTCCAATAATAATGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2567s1c1
Sequence:CCGGGCAGCCAGTGTGCTACATAATCTCGAGATTATGTAGCACACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-1745s1c1
Sequence:CCGGGCATACGATGAAACTACTCAACTCGAGTTGAGTAGTTTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020868
DPP10 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 10 (non-functional)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-716s1c1
Sequence:CCGGCGGTGGATCAATGATACAGATCTCGAGATCTGTATCATTGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2293s1c1
Sequence:CCGGGCAGGAGATTCATCGAAGATTCTCGAGAATCTTCGATGAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-791s1c1
Sequence:CCGGGCTACCACATTATTATTGGAACTCGAGTTCCAATAATAATGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2567s1c1
Sequence:CCGGGCAGCCAGTGTGCTACATAATCTCGAGATTATGTAGCACACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-1745s1c1
Sequence:CCGGGCATACGATGAAACTACTCAACTCGAGTTGAGTAGTTTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020868
DPP10 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 10 (non-functional)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-716s1c1
Sequence:CCGGCGGTGGATCAATGATACAGATCTCGAGATCTGTATCATTGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2293s1c1
Sequence:CCGGGCAGGAGATTCATCGAAGATTCTCGAGAATCTTCGATGAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-791s1c1
Sequence:CCGGGCTACCACATTATTATTGGAACTCGAGTTCCAATAATAATGTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-2567s1c1
Sequence:CCGGGCAGCCAGTGTGCTACATAATCTCGAGATTATGTAGCACACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020868.1-1745s1c1
Sequence:CCGGGCATACGATGAAACTACTCAACTCGAGTTGAGTAGTTTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks