EMAIL THIS PAGE TO A FRIEND

DPP3

dipeptidyl-peptidase 3

131 Gene Product Result for
Synonyms: DPPIII
Gene ID:
Human(10072) Summary: This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(75221) dipeptidylpeptidase 3
Rat(114591) dipeptidylpeptidase 3
naked mole-rat(101721371) dipeptidyl-peptidase 3
domestic guinea pig(100729344) dipeptidyl-peptidase 3
sheep(101115241) dipeptidyl-peptidase 3
Domestic Rabbit(100358846) dipeptidyl-peptidase 3
Zebrafish(322527) dipeptidylpeptidase 3
Horse(100058485) dipeptidyl-peptidase 3
cow(510200) dipeptidyl-peptidase 3
domestic cat(101099587) dipeptidyl-peptidase 3
dog(476011) dipeptidyl-peptidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116871 MISSION® esiRNA esiRNA human DPP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005700 Rosetta Predictions human pricing
NM_130443 Rosetta Predictions human pricing
NM_053748 Rosetta Predictions rat pricing
NM_133803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017904 predicted 1463
2 SASI_Hs01_00017905 predicted 562
3 SASI_Hs01_00017906 predicted 1776
4 SASI_Hs01_00017908 predicted 1042
5 SASI_Hs01_00017909 predicted 597
6 SASI_Hs01_00017910 predicted 981
7 SASI_Hs01_00017911 predicted 288
8 SASI_Hs01_00017912 predicted 372
9 SASI_Hs01_00017913 predicted 1757
10 SASI_Hs02_00340100 predicted 596
11 SASI_Hs01_00017907 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090569 predicted 1462
2 SASI_Hs01_00090570 predicted 562
3 SASI_Hs01_00090571 predicted 1775
4 SASI_Hs01_00090573 predicted 1050
5 SASI_Hs01_00090574 predicted 607
6 SASI_Hs01_00090575 predicted 986
7 SASI_Hs01_00090576 predicted 284
8 SASI_Hs01_00090577 predicted 367
9 SASI_Hs01_00090578 predicted 1763
10 SASI_Hs02_00362743 predicted 598
11 SASI_Hs01_00090572 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087376 predicted 699
2 SASI_Rn01_00087377 predicted 1981
3 SASI_Rn01_00087378 predicted 694
4 SASI_Rn01_00087379 predicted 1382
5 SASI_Rn01_00087381 predicted 872
6 SASI_Rn02_00266532 predicted 1726
7 SASI_Rn01_00087382 predicted 835
8 SASI_Rn01_00087383 predicted 1498
9 SASI_Rn01_00087384 predicted 1788
10 SASI_Rn02_00266533 predicted 1727
11 SASI_Rn01_00087380 predicted 826
12 SASI_Rn01_00087385 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063075 predicted 1185
2 SASI_Mm01_00063076 predicted 934
3 SASI_Mm01_00063077 predicted 2268
4 SASI_Mm01_00063078 predicted 253
5 SASI_Mm01_00063079 predicted 924
6 SASI_Mm01_00063080 predicted 1491
7 SASI_Mm01_00063081 predicted 1615
8 SASI_Mm01_00063082 predicted 323
9 SASI_Mm01_00063083 predicted 415
10 SASI_Mm01_00063084 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005700
VALIDATED
DPP3 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1018s1c1
Sequence:CCGGCCCGAGGAGAATTTGAAGGTTCTCGAGAACCTTCAAATTCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1244s1c1
Sequence:CCGGGCAGACGGAAGGCTTTAAGAACTCGAGTTCTTAAAGCCTTCCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-335s1c1
Sequence:CCGGCGCGGGTGTTTACTCCAACATCTCGAGATGTTGGAGTAAACACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-553s1c1
Sequence:CCGGCCACCTATTTCTCTGGGAATTCTCGAGAATTCCCAGAGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-1449s1c1
Sequence:CCGGGCATTCAACTTTGACCAGGAACTCGAGTTCCTGGTCAAAGTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005700
VALIDATED
DPP3 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1018s1c1
Sequence:CCGGCCCGAGGAGAATTTGAAGGTTCTCGAGAACCTTCAAATTCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1244s1c1
Sequence:CCGGGCAGACGGAAGGCTTTAAGAACTCGAGTTCTTAAAGCCTTCCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-335s1c1
Sequence:CCGGCGCGGGTGTTTACTCCAACATCTCGAGATGTTGGAGTAAACACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-553s1c1
Sequence:CCGGCCACCTATTTCTCTGGGAATTCTCGAGAATTCCCAGAGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-1449s1c1
Sequence:CCGGGCATTCAACTTTGACCAGGAACTCGAGTTCCTGGTCAAAGTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005700
VALIDATED
DPP3 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1018s1c1
Sequence:CCGGCCCGAGGAGAATTTGAAGGTTCTCGAGAACCTTCAAATTCTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005700.2-1244s1c1
Sequence:CCGGGCAGACGGAAGGCTTTAAGAACTCGAGTTCTTAAAGCCTTCCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-335s1c1
Sequence:CCGGCGCGGGTGTTTACTCCAACATCTCGAGATGTTGGAGTAAACACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-553s1c1
Sequence:CCGGCCACCTATTTCTCTGGGAATTCTCGAGAATTCCCAGAGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005700.2-1449s1c1
Sequence:CCGGGCATTCAACTTTGACCAGGAACTCGAGTTCCTGGTCAAAGTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133803
VALIDATED
DPP3 MISSION shRNA Bacterial Glycerol Stock
dipeptidyl-peptidase 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-931s1c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133803.1-684s1c1
Sequence:CCGGCCCTGCTCTTGACTCTGAATTCTCGAGAATTCAGAGTCAAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-345s1c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-1632s1c1
Sequence:CCGGCTACGTGAACTGGCTCAACATCTCGAGATGTTGAGCCAGTTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-511s21c1
Sequence:CCGGGAGGGAGTCACCACCTATTTCCTCGAGGAAATAGGTGGTGACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-931s21c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2479s21c1
Sequence:CCGGGGATCTGCACTGCCATCTATGCTCGAGCATAGATGGCAGTGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-1491s21c1
Sequence:CCGGAGAGACGTGGGATAGCAAATTCTCGAGAATTTGCTATCCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-345s21c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-2399s21c1
Sequence:CCGGTTACCGTATGTCCTCAGTTTCCTCGAGGAAACTGAGGACATACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2070s21c1
Sequence:CCGGAGGAGTCCCGGAAGCTTATTGCTCGAGCAATAAGCTTCCGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133803
VALIDATED
DPP3 MISSION shRNA shRNA Plasmid DNA
dipeptidyl-peptidase 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-931s1c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133803.1-684s1c1
Sequence:CCGGCCCTGCTCTTGACTCTGAATTCTCGAGAATTCAGAGTCAAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-345s1c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-1632s1c1
Sequence:CCGGCTACGTGAACTGGCTCAACATCTCGAGATGTTGAGCCAGTTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-511s21c1
Sequence:CCGGGAGGGAGTCACCACCTATTTCCTCGAGGAAATAGGTGGTGACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-931s21c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2479s21c1
Sequence:CCGGGGATCTGCACTGCCATCTATGCTCGAGCATAGATGGCAGTGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-1491s21c1
Sequence:CCGGAGAGACGTGGGATAGCAAATTCTCGAGAATTTGCTATCCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-345s21c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-2399s21c1
Sequence:CCGGTTACCGTATGTCCTCAGTTTCCTCGAGGAAACTGAGGACATACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2070s21c1
Sequence:CCGGAGGAGTCCCGGAAGCTTATTGCTCGAGCAATAAGCTTCCGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133803
VALIDATED
DPP3 MISSION shRNA Lentiviral Transduction Particles
dipeptidyl-peptidase 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-931s1c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133803.1-684s1c1
Sequence:CCGGCCCTGCTCTTGACTCTGAATTCTCGAGAATTCAGAGTCAAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-345s1c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133803.1-1632s1c1
Sequence:CCGGCTACGTGAACTGGCTCAACATCTCGAGATGTTGAGCCAGTTCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-511s21c1
Sequence:CCGGGAGGGAGTCACCACCTATTTCCTCGAGGAAATAGGTGGTGACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-931s21c1
Sequence:CCGGCCCATTGTAGAGAGTTACATTCTCGAGAATGTAACTCTCTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2479s21c1
Sequence:CCGGGGATCTGCACTGCCATCTATGCTCGAGCATAGATGGCAGTGCAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-1491s21c1
Sequence:CCGGAGAGACGTGGGATAGCAAATTCTCGAGAATTTGCTATCCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133803.1-345s21c1
Sequence:CCGGTGACACCAAGTTTGTTCCTAACTCGAGTTAGGAACAAACTTGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.1-2399s21c1
Sequence:CCGGTTACCGTATGTCCTCAGTTTCCTCGAGGAAACTGAGGACATACGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133803.2-2070s21c1
Sequence:CCGGAGGAGTCCCGGAAGCTTATTGCTCGAGCAATAAGCTTCCGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks